Incidental Mutation 'R7599:Hc'
ID 587875
Institutional Source Beutler Lab
Gene Symbol Hc
Ensembl Gene ENSMUSG00000026874
Gene Name hemolytic complement
Synonyms He, C5, C5a
MMRRC Submission
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.487) question?
Stock # R7599 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 34983331-35061438 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 35050419 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 136 (T136S)
Ref Sequence ENSEMBL: ENSMUSP00000028233 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028233]
AlphaFold P06684
PDB Structure Crystal structure of the mouse C5a anaphylatoxin [X-RAY DIFFRACTION]
Crystal structure of the mouse C5a-desArg anaphylatoxin [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000028233
AA Change: T136S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028233
Gene: ENSMUSG00000026874
AA Change: T136S

DomainStartEndE-ValueType
Pfam:A2M_N 125 219 1.8e-15 PFAM
A2M_N_2 465 612 9.83e-34 SMART
ANATO 702 736 4.73e-12 SMART
A2M 776 863 2.44e-29 SMART
Pfam:A2M_comp 1055 1306 2.3e-68 PFAM
A2M_recep 1423 1513 7.29e-28 SMART
C345C 1553 1665 1.51e-35 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a component of the complement system, a part of the innate immune system that plays an important role in inflammation, host homeostasis, and host defense against pathogens. The encoded preproprotein is proteolytically processed to generate multiple protein products, including the C5 alpha chain, C5 beta chain, C5a anaphylatoxin and C5b. The C5 protein is comprised of the alpha and beta chains, which are linked by a disulfide bridge. Cleavage of the alpha chain by a convertase enzyme results in the formation of the C5a anaphylatoxin, which possesses potent spasmogenic and chemotactic activity, and the C5b macromolecular cleavage product, a subunit of the membrane attack complex (MAC). Mice with a homozygous mutation in this gene exhibit impaired bone fracture healing and an enhanced inflammatory response in an allergic lung disease model. [provided by RefSeq, Nov 2015]
PHENOTYPE: Macrophage from mice homozygous for disruptions of this gene do not secrete complement C5.

The 2 bp deletion found in A/J and AKR/J strains is associated with susceptibility to allergen-induced bronchial hyperresponsiveness and is a candidate for QTL Abhr2.

[provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210016F16Rik T A 13: 58,381,835 H321L probably damaging Het
Adamts3 T C 5: 89,861,397 S136G probably benign Het
Apba3 T A 10: 81,272,346 N445K probably damaging Het
Aqp6 A G 15: 99,603,771 K237E possibly damaging Het
Arhgap23 A G 11: 97,500,343 T1229A probably benign Het
Bpifb1 T C 2: 154,214,151 I379T probably damaging Het
Ccdc169 A G 3: 55,140,109 D7G probably damaging Het
Cyp2f2 T A 7: 27,131,359 probably null Het
Daam2 T A 17: 49,480,727 K453* probably null Het
Dennd4c T C 4: 86,811,612 L817P probably damaging Het
Efcab6 T A 15: 83,870,988 R1376W probably damaging Het
Esrra G T 19: 6,913,846 A182E possibly damaging Het
Fam234b T A 6: 135,226,876 V392E probably damaging Het
Fanca A G 8: 123,271,260 V1229A probably benign Het
Fdps G T 3: 89,099,386 Q66K probably benign Het
Fer1l6 T A 15: 58,627,589 D1269E probably benign Het
Foxred1 G A 9: 35,205,636 R353W probably damaging Het
Gabrg2 C T 11: 41,967,624 V226I possibly damaging Het
Gcnt2 C A 13: 40,860,867 C171* probably null Het
Glyat C A 19: 12,639,808 A8E probably damaging Het
Golgb1 C A 16: 36,875,396 R86S unknown Het
Hdac1 G T 4: 129,517,466 S421* probably null Het
Hmcn2 G T 2: 31,356,286 A756S possibly damaging Het
Igkv8-26 A G 6: 70,193,587 N54S probably benign Het
Impad1 G A 4: 4,778,207 T177I probably damaging Het
Itgae T A 11: 73,121,960 V706E possibly damaging Het
Itgax G A 7: 128,148,090 V992M probably damaging Het
Klk10 A G 7: 43,784,427 D221G probably benign Het
Klkb1 T C 8: 45,278,113 I205V probably benign Het
Kpna2 T C 11: 106,998,757 N8S probably null Het
L3mbtl1 A C 2: 162,964,514 T442P possibly damaging Het
Lrp1b C T 2: 40,661,549 C4181Y Het
Mcat T C 15: 83,547,671 Y332C probably damaging Het
Mecom T C 3: 29,956,385 D648G probably damaging Het
Mesp2 A T 7: 79,810,969 D14V probably damaging Het
Mlh3 A T 12: 85,268,199 Y404* probably null Het
Mterf3 A T 13: 66,917,148 F230I probably damaging Het
Nrxn3 T C 12: 89,512,062 V602A probably benign Het
Olfr1247 T A 2: 89,609,227 I292F possibly damaging Het
Plekhg6 A G 6: 125,374,660 F209L probably damaging Het
Pmp22 C A 11: 63,158,348 A139D probably damaging Het
Polr2e T C 10: 80,038,570 D34G possibly damaging Het
Ppard T A 17: 28,297,117 L105H probably damaging Het
Ptpn14 T A 1: 189,850,745 D596E probably benign Het
Ptprz1 C T 6: 23,002,519 A1536V not run Het
Rabgap1 TGGGG TGGG 2: 37,502,896 probably null Het
Retreg1 T A 15: 25,971,641 D222E probably benign Het
Rmnd1 T C 10: 4,413,404 K282R probably benign Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Sall3 C T 18: 80,972,052 R887H possibly damaging Het
Samd3 A G 10: 26,263,813 D281G probably benign Het
Scube1 T A 15: 83,613,452 D766V probably damaging Het
Sec24b TGC TGCAGC 3: 130,040,811 probably benign Het
Slc2a2 A G 3: 28,698,017 M1V probably null Het
Slc39a2 A T 14: 51,895,031 T144S probably benign Het
Slc5a9 T C 4: 111,877,740 H619R probably benign Het
Slco4a1 T C 2: 180,471,255 F427L probably benign Het
Snapc3 C A 4: 83,417,836 Y28* probably null Het
St3gal6 C T 16: 58,473,437 R243H probably benign Het
Stat2 T A 10: 128,277,197 N119K possibly damaging Het
Syne2 G C 12: 75,966,371 V2779L probably benign Het
Tacc1 T A 8: 25,201,285 M1L probably damaging Het
Tbc1d32 A T 10: 56,151,833 F724L possibly damaging Het
Ttc23l A G 15: 10,533,680 I259T possibly damaging Het
Ucn2 T C 9: 108,986,224 I18T probably benign Het
Wdr35 G C 12: 9,024,886 A1000P probably benign Het
Wnk1 C A 6: 119,929,828 C244F possibly damaging Het
Zeb2 T G 2: 44,994,613 D1022A probably damaging Het
Zfp26 A T 9: 20,437,833 H478Q probably damaging Het
Zfp410 A G 12: 84,331,856 K265R probably benign Het
Zfp575 T C 7: 24,586,668 D21G probably benign Het
Other mutations in Hc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00694:Hc APN 2 34991629 missense probably benign 0.00
IGL00922:Hc APN 2 34991668 missense probably damaging 1.00
IGL01523:Hc APN 2 35039238 missense probably benign 0.04
IGL01746:Hc APN 2 35057326 missense probably damaging 0.98
IGL01793:Hc APN 2 35028190 missense probably damaging 1.00
IGL01972:Hc APN 2 34983772 missense probably damaging 1.00
IGL02037:Hc APN 2 35013519 missense probably benign 0.16
IGL02048:Hc APN 2 34996027 missense probably benign 0.00
IGL02227:Hc APN 2 35009911 intron probably benign
IGL02230:Hc APN 2 35013670 missense probably benign
IGL02254:Hc APN 2 34984824 missense probably damaging 1.00
IGL02363:Hc APN 2 35000835 missense probably benign
IGL02650:Hc APN 2 35000874 missense possibly damaging 0.49
IGL03053:Hc APN 2 35024198 missense probably benign 0.07
IGL03168:Hc APN 2 35024198 missense probably benign 0.07
IGL03341:Hc APN 2 35003377 missense probably damaging 0.98
PIT4142001:Hc UTSW 2 35031821 splice site probably benign
PIT4378001:Hc UTSW 2 35031864 missense probably benign 0.13
PIT4508001:Hc UTSW 2 34984804 missense probably damaging 0.96
PIT4812001:Hc UTSW 2 35029452 missense probably benign 0.16
R0025:Hc UTSW 2 34986292 missense probably damaging 1.00
R0053:Hc UTSW 2 35057275 missense probably benign 0.32
R0197:Hc UTSW 2 34984750 missense probably damaging 1.00
R0218:Hc UTSW 2 35028074 missense probably damaging 1.00
R0242:Hc UTSW 2 35036154 splice site probably benign
R0496:Hc UTSW 2 35013571 missense probably damaging 1.00
R1205:Hc UTSW 2 35003524 missense possibly damaging 0.50
R1468:Hc UTSW 2 34983807 nonsense probably null
R1468:Hc UTSW 2 34983807 nonsense probably null
R1574:Hc UTSW 2 35000765 intron probably benign
R1610:Hc UTSW 2 35006161 missense probably benign 0.44
R1640:Hc UTSW 2 35057324 nonsense probably null
R1887:Hc UTSW 2 35034611 missense probably benign
R1920:Hc UTSW 2 35029395 splice site probably benign
R2018:Hc UTSW 2 35013528 missense probably damaging 1.00
R2019:Hc UTSW 2 35013528 missense probably damaging 1.00
R2151:Hc UTSW 2 34991103 intron probably benign
R2366:Hc UTSW 2 35013636 missense probably benign
R4093:Hc UTSW 2 34983807 nonsense probably null
R4288:Hc UTSW 2 35030402 missense probably damaging 0.98
R4501:Hc UTSW 2 34997476 splice site probably null
R4502:Hc UTSW 2 35006252 missense probably benign 0.00
R4508:Hc UTSW 2 35013065 missense possibly damaging 0.94
R4583:Hc UTSW 2 35028177 missense probably benign 0.00
R4686:Hc UTSW 2 35039248 missense possibly damaging 0.49
R4776:Hc UTSW 2 35039734 missense probably benign 0.12
R4846:Hc UTSW 2 35019670 missense probably benign 0.00
R5032:Hc UTSW 2 35013532 missense probably benign 0.07
R5089:Hc UTSW 2 35024890 missense probably benign 0.01
R5289:Hc UTSW 2 34996014 critical splice donor site probably null
R5347:Hc UTSW 2 35037624 missense probably benign 0.04
R5356:Hc UTSW 2 34994995 missense probably benign 0.00
R5379:Hc UTSW 2 34991065 missense probably damaging 1.00
R5403:Hc UTSW 2 35057434 missense probably damaging 1.00
R5418:Hc UTSW 2 35008183 critical splice donor site probably null
R5450:Hc UTSW 2 35013038 missense possibly damaging 0.67
R5494:Hc UTSW 2 35003539 splice site probably null
R5713:Hc UTSW 2 35013531 missense probably damaging 0.99
R5898:Hc UTSW 2 34997437 missense probably benign 0.06
R5925:Hc UTSW 2 35030450 missense possibly damaging 0.92
R5942:Hc UTSW 2 35028125 nonsense probably null
R5991:Hc UTSW 2 35006105 missense possibly damaging 0.91
R6036:Hc UTSW 2 35039684 missense probably benign 0.00
R6036:Hc UTSW 2 35039684 missense probably benign 0.00
R6115:Hc UTSW 2 35013038 missense probably damaging 1.00
R6234:Hc UTSW 2 35028046 missense probably benign
R6264:Hc UTSW 2 35006273 critical splice acceptor site probably null
R6313:Hc UTSW 2 34989839 splice site probably null
R6525:Hc UTSW 2 34991224 missense probably benign 0.06
R6577:Hc UTSW 2 35032126 missense probably benign 0.00
R6601:Hc UTSW 2 35045894 missense probably benign 0.03
R6916:Hc UTSW 2 35010032 nonsense probably null
R7108:Hc UTSW 2 35039694 missense probably benign 0.03
R7143:Hc UTSW 2 35050438 missense probably benign 0.00
R7388:Hc UTSW 2 34984847 splice site probably null
R7468:Hc UTSW 2 35028051 missense probably benign 0.00
R7504:Hc UTSW 2 35061319 missense not run
R7521:Hc UTSW 2 35045332 missense possibly damaging 0.80
R7582:Hc UTSW 2 34991266 missense possibly damaging 0.70
R7596:Hc UTSW 2 35000847 missense probably damaging 0.96
R7692:Hc UTSW 2 35024149 missense probably damaging 1.00
R7853:Hc UTSW 2 35010033 missense probably damaging 1.00
R7877:Hc UTSW 2 34997399 nonsense probably null
R8329:Hc UTSW 2 35012898 splice site probably null
R8375:Hc UTSW 2 34983719 missense probably benign 0.32
R8477:Hc UTSW 2 34989170 missense probably damaging 1.00
R8810:Hc UTSW 2 35019523 missense probably benign 0.06
R8888:Hc UTSW 2 35000849 missense probably benign 0.00
R8895:Hc UTSW 2 35000849 missense probably benign 0.00
R8968:Hc UTSW 2 35032305 missense possibly damaging 0.91
R8969:Hc UTSW 2 35019463 critical splice donor site probably null
R9146:Hc UTSW 2 35034559 missense probably damaging 1.00
R9218:Hc UTSW 2 35032191 missense probably damaging 1.00
R9340:Hc UTSW 2 34986282 missense probably damaging 0.99
R9396:Hc UTSW 2 35037603 nonsense probably null
R9569:Hc UTSW 2 35036347 missense probably benign 0.00
R9576:Hc UTSW 2 34983755 missense probably benign 0.01
R9706:Hc UTSW 2 35024184 missense probably damaging 1.00
X0066:Hc UTSW 2 34983711 missense probably damaging 1.00
Z1088:Hc UTSW 2 35008249 missense possibly damaging 0.94
Z1088:Hc UTSW 2 35029470 missense probably benign 0.02
Z1176:Hc UTSW 2 35006273 critical splice acceptor site probably null
Z1177:Hc UTSW 2 35013610 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCTTCAAAGAGGCTTGTTTTG -3'
(R):5'- CCAAATGATGTAGCATGCAATATCG -3'

Sequencing Primer
(F):5'- ACTCACTATGTAGACCAGGCTGG -3'
(R):5'- TGGCATGCTTAGAGTTATGCTC -3'
Posted On 2019-10-24