Mutagenetix > Incidental Mutation

Incidental Mutation 'R7599:L3mbtl1'

587881

Institutional Source

Beutler Lab

Gene Symbol

L3mbtl1

Ensembl Gene

ENSMUSG00000035576

Gene Name

L3MBTL1 histone methyl-lysine binding protein

Synonyms

L3MBTL1

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7599 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

162943472-162974522 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 162964514 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Proline at position 442 (T442P)

Ref Sequence

ENSEMBL: ENSMUSP00000044038 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035751]

AlphaFold

A2A5N8

Predicted Effect

possibly damaging
Transcript: ENSMUST00000035751
AA Change: T442P

PolyPhen 2 Score 0.705 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000044038
Gene: ENSMUSG00000035576
AA Change: T442P

Domain	Start	End	E-Value	Type
low complexity region	234	242	N/A	INTRINSIC
MBT	280	380	5.34e-53	SMART
MBT	388	487	2.17e-53	SMART
MBT	496	591	1.49e-51	SMART
Pfam:zf-C2HC	627	655	1.7e-17	PFAM
SAM	754	821	3.49e-8	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene represents a polycomb group gene. The encoded protein functions to regulate gene activity, likely via chromatin modification. The encoded protein may also be necessary for mitosis. Alternatively spliced transcript variants encoding different isoforms have been identified.[provided by RefSeq, Sep 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal nervous system phenotype, hematopoietic system phenotype, immune system phenotype, cellular phenotype, and lifespan. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2210016F16Rik	T	A	13: 58,381,835	H321L	probably damaging	Het
Adamts3	T	C	5: 89,861,397	S136G	probably benign	Het
Apba3	T	A	10: 81,272,346	N445K	probably damaging	Het
Aqp6	A	G	15: 99,603,771	K237E	possibly damaging	Het
Arhgap23	A	G	11: 97,500,343	T1229A	probably benign	Het
Bpifb1	T	C	2: 154,214,151	I379T	probably damaging	Het
Ccdc169	A	G	3: 55,140,109	D7G	probably damaging	Het
Cyp2f2	T	A	7: 27,131,359		probably null	Het
Daam2	T	A	17: 49,480,727	K453*	probably null	Het
Dennd4c	T	C	4: 86,811,612	L817P	probably damaging	Het
Efcab6	T	A	15: 83,870,988	R1376W	probably damaging	Het
Esrra	G	T	19: 6,913,846	A182E	possibly damaging	Het
Fam234b	T	A	6: 135,226,876	V392E	probably damaging	Het
Fanca	A	G	8: 123,271,260	V1229A	probably benign	Het
Fdps	G	T	3: 89,099,386	Q66K	probably benign	Het
Fer1l6	T	A	15: 58,627,589	D1269E	probably benign	Het
Foxred1	G	A	9: 35,205,636	R353W	probably damaging	Het
Gabrg2	C	T	11: 41,967,624	V226I	possibly damaging	Het
Gcnt2	C	A	13: 40,860,867	C171*	probably null	Het
Glyat	C	A	19: 12,639,808	A8E	probably damaging	Het
Golgb1	C	A	16: 36,875,396	R86S	unknown	Het
Hc	T	A	2: 35,050,419	T136S	probably damaging	Het
Hdac1	G	T	4: 129,517,466	S421*	probably null	Het
Hmcn2	G	T	2: 31,356,286	A756S	possibly damaging	Het
Igkv8-26	A	G	6: 70,193,587	N54S	probably benign	Het
Impad1	G	A	4: 4,778,207	T177I	probably damaging	Het
Itgae	T	A	11: 73,121,960	V706E	possibly damaging	Het
Itgax	G	A	7: 128,148,090	V992M	probably damaging	Het
Klk10	A	G	7: 43,784,427	D221G	probably benign	Het
Klkb1	T	C	8: 45,278,113	I205V	probably benign	Het
Kpna2	T	C	11: 106,998,757	N8S	probably null	Het
Lrp1b	C	T	2: 40,661,549	C4181Y		Het
Mcat	T	C	15: 83,547,671	Y332C	probably damaging	Het
Mecom	T	C	3: 29,956,385	D648G	probably damaging	Het
Mesp2	A	T	7: 79,810,969	D14V	probably damaging	Het
Mlh3	A	T	12: 85,268,199	Y404*	probably null	Het
Mterf3	A	T	13: 66,917,148	F230I	probably damaging	Het
Nrxn3	T	C	12: 89,512,062	V602A	probably benign	Het
Olfr1247	T	A	2: 89,609,227	I292F	possibly damaging	Het
Plekhg6	A	G	6: 125,374,660	F209L	probably damaging	Het
Pmp22	C	A	11: 63,158,348	A139D	probably damaging	Het
Polr2e	T	C	10: 80,038,570	D34G	possibly damaging	Het
Ppard	T	A	17: 28,297,117	L105H	probably damaging	Het
Ptpn14	T	A	1: 189,850,745	D596E	probably benign	Het
Ptprz1	C	T	6: 23,002,519	A1536V	not run	Het
Rabgap1	TGGGG	TGGG	2: 37,502,896		probably null	Het
Retreg1	T	A	15: 25,971,641	D222E	probably benign	Het
Rmnd1	T	C	10: 4,413,404	K282R	probably benign	Het
Rsf1	ATGGCG	ATGGCGACGGTGGCG	7: 97,579,904		probably benign	Het
Sall3	C	T	18: 80,972,052	R887H	possibly damaging	Het
Samd3	A	G	10: 26,263,813	D281G	probably benign	Het
Scube1	T	A	15: 83,613,452	D766V	probably damaging	Het
Sec24b	TGC	TGCAGC	3: 130,040,811		probably benign	Het
Slc2a2	A	G	3: 28,698,017	M1V	probably null	Het
Slc39a2	A	T	14: 51,895,031	T144S	probably benign	Het
Slc5a9	T	C	4: 111,877,740	H619R	probably benign	Het
Slco4a1	T	C	2: 180,471,255	F427L	probably benign	Het
Snapc3	C	A	4: 83,417,836	Y28*	probably null	Het
St3gal6	C	T	16: 58,473,437	R243H	probably benign	Het
Stat2	T	A	10: 128,277,197	N119K	possibly damaging	Het
Syne2	G	C	12: 75,966,371	V2779L	probably benign	Het
Tacc1	T	A	8: 25,201,285	M1L	probably damaging	Het
Tbc1d32	A	T	10: 56,151,833	F724L	possibly damaging	Het
Ttc23l	A	G	15: 10,533,680	I259T	possibly damaging	Het
Ucn2	T	C	9: 108,986,224	I18T	probably benign	Het
Wdr35	G	C	12: 9,024,886	A1000P	probably benign	Het
Wnk1	C	A	6: 119,929,828	C244F	possibly damaging	Het
Zeb2	T	G	2: 44,994,613	D1022A	probably damaging	Het
Zfp26	A	T	9: 20,437,833	H478Q	probably damaging	Het
Zfp410	A	G	12: 84,331,856	K265R	probably benign	Het
Zfp575	T	C	7: 24,586,668	D21G	probably benign	Het

Other mutations in L3mbtl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00236:L3mbtl1	APN	2	162967063	missense	probably damaging	1.00
IGL01090:L3mbtl1	APN	2	162966005	missense	probably damaging	1.00
IGL01291:L3mbtl1	APN	2	162970180	missense	probably benign	0.30
IGL02897:L3mbtl1	APN	2	162965772	missense	probably damaging	1.00
IGL02974:L3mbtl1	APN	2	162970183	missense	possibly damaging	0.68
IGL02986:L3mbtl1	APN	2	162970305	missense	probably damaging	1.00
IGL03057:L3mbtl1	APN	2	162967383	missense	probably damaging	1.00
IGL03372:L3mbtl1	APN	2	162971157	splice site	probably benign
ANU05:L3mbtl1	UTSW	2	162970180	missense	probably benign	0.30
R0006:L3mbtl1	UTSW	2	162964569	missense	possibly damaging	0.94
R0006:L3mbtl1	UTSW	2	162964569	missense	possibly damaging	0.94
R0067:L3mbtl1	UTSW	2	162948828	missense	probably damaging	1.00
R0067:L3mbtl1	UTSW	2	162948828	missense	probably damaging	1.00
R0078:L3mbtl1	UTSW	2	162947226	missense	probably benign	0.12
R0505:L3mbtl1	UTSW	2	162947335	splice site	probably benign
R0748:L3mbtl1	UTSW	2	162971163	splice site	probably benign
R0748:L3mbtl1	UTSW	2	162971164	critical splice acceptor site	probably null
R0761:L3mbtl1	UTSW	2	162966047	missense	probably damaging	1.00
R1789:L3mbtl1	UTSW	2	162974502	missense	probably benign
R1970:L3mbtl1	UTSW	2	162959572	missense	probably damaging	1.00
R2114:L3mbtl1	UTSW	2	162960070	splice site	probably null
R2115:L3mbtl1	UTSW	2	162960070	splice site	probably null
R2116:L3mbtl1	UTSW	2	162960070	splice site	probably null
R2117:L3mbtl1	UTSW	2	162960070	splice site	probably null
R2513:L3mbtl1	UTSW	2	162967585	missense	probably benign
R3848:L3mbtl1	UTSW	2	162948201	missense	probably damaging	1.00
R4877:L3mbtl1	UTSW	2	162948568	missense	probably damaging	0.98
R4930:L3mbtl1	UTSW	2	162965772	missense	probably damaging	1.00
R5930:L3mbtl1	UTSW	2	162967336	small deletion	probably benign
R5932:L3mbtl1	UTSW	2	162967336	small deletion	probably benign
R6562:L3mbtl1	UTSW	2	162970204	missense	probably benign	0.28
R6601:L3mbtl1	UTSW	2	162948175	start gained	probably benign
R6995:L3mbtl1	UTSW	2	162961448	missense	probably damaging	1.00
R7188:L3mbtl1	UTSW	2	162949540	critical splice donor site	probably null
R7346:L3mbtl1	UTSW	2	162967006	missense	probably benign	0.01
R7379:L3mbtl1	UTSW	2	162960979	missense	probably damaging	1.00
R7474:L3mbtl1	UTSW	2	162966604	missense	probably damaging	1.00
R7553:L3mbtl1	UTSW	2	162948231	missense	probably benign	0.01
R8745:L3mbtl1	UTSW	2	162970217	missense	probably benign	0.08
R8910:L3mbtl1	UTSW	2	162970293	missense	probably benign	0.00
R9039:L3mbtl1	UTSW	2	162966068	missense	probably damaging	1.00
R9216:L3mbtl1	UTSW	2	162965052	missense	probably benign	0.04
R9253:L3mbtl1	UTSW	2	162947712	missense	probably benign	0.00
R9483:L3mbtl1	UTSW	2	162948814	missense	probably benign	0.01
R9509:L3mbtl1	UTSW	2	162967383	missense	probably damaging	1.00
R9683:L3mbtl1	UTSW	2	162970308	missense	possibly damaging	0.88
R9688:L3mbtl1	UTSW	2	162948777	missense	possibly damaging	0.90

Predicted Primers

PCR Primer
(F):5'- AGGCAATCCTTGTAGGGAAC -3'
(R):5'- GATACACGGGACAGCTCACTAC -3'

Sequencing Primer
(F):5'- GGAACCCACTCCTGTGTTTAC -3'
(R):5'- GGGACAGCTCACTACCTACTC -3'

Posted On

2019-10-24