Incidental Mutation 'R7599:Slco4a1'
ID587882
Institutional Source Beutler Lab
Gene Symbol Slco4a1
Ensembl Gene ENSMUSG00000038963
Gene Namesolute carrier organic anion transporter family, member 4a1
SynonymsSlc21a12, OATP-E
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock #R7599 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location180456245-180474867 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 180471255 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 427 (F427L)
Ref Sequence ENSEMBL: ENSMUSP00000045023 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038225] [ENSMUST00000038259]
Predicted Effect probably benign
Transcript: ENSMUST00000038225
AA Change: F427L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000045023
Gene: ENSMUSG00000038963
AA Change: F427L

DomainStartEndE-ValueType
low complexity region 33 46 N/A INTRINSIC
Pfam:OATP 103 665 5.7e-168 PFAM
Pfam:MFS_1 105 496 3e-15 PFAM
Pfam:Kazal_2 512 555 1.1e-7 PFAM
transmembrane domain 668 690 N/A INTRINSIC
low complexity region 701 718 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000038259
AA Change: F427L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000046502
Gene: ENSMUSG00000038963
AA Change: F427L

DomainStartEndE-ValueType
low complexity region 33 46 N/A INTRINSIC
Pfam:OATP 101 666 2.8e-172 PFAM
Pfam:MFS_1 105 496 2.5e-15 PFAM
Pfam:Kazal_2 512 555 7.7e-8 PFAM
transmembrane domain 668 690 N/A INTRINSIC
low complexity region 701 718 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210016F16Rik T A 13: 58,381,835 H321L probably damaging Het
Adamts3 T C 5: 89,861,397 S136G probably benign Het
Apba3 T A 10: 81,272,346 N445K probably damaging Het
Aqp6 A G 15: 99,603,771 K237E possibly damaging Het
Arhgap23 A G 11: 97,500,343 T1229A probably benign Het
Bpifb1 T C 2: 154,214,151 I379T probably damaging Het
Ccdc169 A G 3: 55,140,109 D7G probably damaging Het
Cyp2f2 T A 7: 27,131,359 probably null Het
Daam2 T A 17: 49,480,727 K453* probably null Het
Dennd4c T C 4: 86,811,612 L817P probably damaging Het
Efcab6 T A 15: 83,870,988 R1376W probably damaging Het
Esrra G T 19: 6,913,846 A182E possibly damaging Het
Fam234b T A 6: 135,226,876 V392E probably damaging Het
Fanca A G 8: 123,271,260 V1229A probably benign Het
Fdps G T 3: 89,099,386 Q66K probably benign Het
Fer1l6 T A 15: 58,627,589 D1269E probably benign Het
Foxred1 G A 9: 35,205,636 R353W probably damaging Het
Gabrg2 C T 11: 41,967,624 V226I possibly damaging Het
Gcnt2 C A 13: 40,860,867 C171* probably null Het
Glyat C A 19: 12,639,808 A8E probably damaging Het
Golgb1 C A 16: 36,875,396 R86S unknown Het
Hc T A 2: 35,050,419 T136S probably damaging Het
Hdac1 G T 4: 129,517,466 S421* probably null Het
Hmcn2 G T 2: 31,356,286 A756S possibly damaging Het
Igkv8-26 A G 6: 70,193,587 N54S probably benign Het
Impad1 G A 4: 4,778,207 T177I probably damaging Het
Itgae T A 11: 73,121,960 V706E possibly damaging Het
Itgax G A 7: 128,148,090 V992M probably damaging Het
Klk10 A G 7: 43,784,427 D221G probably benign Het
Klkb1 T C 8: 45,278,113 I205V probably benign Het
Kpna2 T C 11: 106,998,757 N8S probably null Het
L3mbtl1 A C 2: 162,964,514 T442P possibly damaging Het
Lrp1b C T 2: 40,661,549 C4181Y Het
Mcat T C 15: 83,547,671 Y332C probably damaging Het
Mecom T C 3: 29,956,385 D648G probably damaging Het
Mesp2 A T 7: 79,810,969 D14V probably damaging Het
Mlh3 A T 12: 85,268,199 Y404* probably null Het
Mterf3 A T 13: 66,917,148 F230I probably damaging Het
Nrxn3 T C 12: 89,512,062 V602A probably benign Het
Olfr1247 T A 2: 89,609,227 I292F possibly damaging Het
Plekhg6 A G 6: 125,374,660 F209L probably damaging Het
Pmp22 C A 11: 63,158,348 A139D probably damaging Het
Polr2e T C 10: 80,038,570 D34G possibly damaging Het
Ppard T A 17: 28,297,117 L105H probably damaging Het
Ptpn14 T A 1: 189,850,745 D596E probably benign Het
Ptprz1 C T 6: 23,002,519 A1536V not run Het
Rabgap1 TGGGG TGGG 2: 37,502,896 probably null Het
Retreg1 T A 15: 25,971,641 D222E probably benign Het
Rmnd1 T C 10: 4,413,404 K282R probably benign Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Sall3 C T 18: 80,972,052 R887H possibly damaging Het
Samd3 A G 10: 26,263,813 D281G probably benign Het
Scube1 T A 15: 83,613,452 D766V probably damaging Het
Sec24b TGC TGCAGC 3: 130,040,811 probably benign Het
Slc2a2 A G 3: 28,698,017 M1V probably null Het
Slc39a2 A T 14: 51,895,031 T144S probably benign Het
Slc5a9 T C 4: 111,877,740 H619R probably benign Het
Snapc3 C A 4: 83,417,836 Y28* probably null Het
St3gal6 C T 16: 58,473,437 R243H probably benign Het
Stat2 T A 10: 128,277,197 N119K possibly damaging Het
Syne2 G C 12: 75,966,371 V2779L probably benign Het
Tacc1 T A 8: 25,201,285 M1L probably damaging Het
Tbc1d32 A T 10: 56,151,833 F724L possibly damaging Het
Ttc23l A G 15: 10,533,680 I259T possibly damaging Het
Ucn2 T C 9: 108,986,224 I18T probably benign Het
Wdr35 G C 12: 9,024,886 A1000P probably benign Het
Wnk1 C A 6: 119,929,828 C244F possibly damaging Het
Zeb2 T G 2: 44,994,613 D1022A probably damaging Het
Zfp26 A T 9: 20,437,833 H478Q probably damaging Het
Zfp410 A G 12: 84,331,856 K265R probably benign Het
Zfp575 T C 7: 24,586,668 D21G probably benign Het
Other mutations in Slco4a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01745:Slco4a1 APN 2 180464679 missense probably damaging 1.00
IGL01982:Slco4a1 APN 2 180473153 missense probably benign 0.03
IGL02297:Slco4a1 APN 2 180464489 missense probably benign 0.16
IGL02368:Slco4a1 APN 2 180473128 missense probably damaging 0.98
R1621:Slco4a1 UTSW 2 180471132 missense probably benign 0.01
R2275:Slco4a1 UTSW 2 180464736 missense possibly damaging 0.94
R2472:Slco4a1 UTSW 2 180467087 missense probably damaging 1.00
R3851:Slco4a1 UTSW 2 180464091 missense probably benign 0.00
R3852:Slco4a1 UTSW 2 180464091 missense probably benign 0.00
R4271:Slco4a1 UTSW 2 180474210 missense possibly damaging 0.85
R4439:Slco4a1 UTSW 2 180472662 missense probably benign 0.02
R4571:Slco4a1 UTSW 2 180464378 missense probably benign 0.32
R4732:Slco4a1 UTSW 2 180473615 missense probably damaging 1.00
R4733:Slco4a1 UTSW 2 180473615 missense probably damaging 1.00
R4925:Slco4a1 UTSW 2 180472056 missense probably benign 0.35
R5156:Slco4a1 UTSW 2 180472779 missense probably benign 0.01
R5186:Slco4a1 UTSW 2 180473108 missense probably damaging 1.00
R5252:Slco4a1 UTSW 2 180464459 missense possibly damaging 0.48
R5426:Slco4a1 UTSW 2 180471235 missense possibly damaging 0.84
R5470:Slco4a1 UTSW 2 180474114 missense probably benign 0.00
R5512:Slco4a1 UTSW 2 180474114 missense possibly damaging 0.91
R6969:Slco4a1 UTSW 2 180464808 missense probably benign
R7133:Slco4a1 UTSW 2 180472063 missense possibly damaging 0.93
R7249:Slco4a1 UTSW 2 180464811 missense probably benign 0.01
R7357:Slco4a1 UTSW 2 180472137 missense probably benign 0.00
R7442:Slco4a1 UTSW 2 180474126 missense probably benign
R7750:Slco4a1 UTSW 2 180471237 missense probably benign 0.30
R7834:Slco4a1 UTSW 2 180465677 missense probably benign
R7917:Slco4a1 UTSW 2 180465677 missense probably benign
Predicted Primers PCR Primer
(F):5'- AACGGCAGGTTCCTTGCATG -3'
(R):5'- CTGGCCCAAACCCTTTCTGTAAG -3'

Sequencing Primer
(F):5'- GCAGGTTCCTTGCATGCAGTC -3'
(R):5'- CTTTCTGTAAGGAGTGGTAGGTAAAG -3'
Posted On2019-10-24