Incidental Mutation 'R7599:Slc2a2'
ID 587883
Institutional Source Beutler Lab
Gene Symbol Slc2a2
Ensembl Gene ENSMUSG00000027690
Gene Name solute carrier family 2 (facilitated glucose transporter), member 2
Synonyms liver-type glucose transporter, Glut2, Glut-2
MMRRC Submission 045673-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7599 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 28752052-28782510 bp(+) (GRCm39)
Type of Mutation start codon destroyed
DNA Base Change (assembly) A to G at 28752166 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Valine at position 1 (M1V)
Ref Sequence ENSEMBL: ENSMUSP00000029240 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029240] [ENSMUST00000163536]
AlphaFold P14246
Predicted Effect probably null
Transcript: ENSMUST00000029240
AA Change: M1V

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000029240
Gene: ENSMUSG00000027690
AA Change: M1V

DomainStartEndE-ValueType
Pfam:MFS_1 9 442 4.2e-23 PFAM
Pfam:Sugar_tr 13 498 2.4e-165 PFAM
Pfam:Folate_carrier 187 458 5.3e-12 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000163536
AA Change: M1V

PolyPhen 2 Score 0.363 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000131046
Gene: ENSMUSG00000027690
AA Change: M1V

DomainStartEndE-ValueType
Pfam:Sugar_tr 13 133 3.9e-19 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an integral plasma membrane glycoprotein of the liver, islet beta cells, intestine, and kidney epithelium. The encoded protein mediates facilitated bidirectional glucose transport. Because of its low affinity for glucose, it has been suggested as a glucose sensor. Mutations in this gene are associated with susceptibility to diseases, including Fanconi-Bickel syndrome and noninsulin-dependent diabetes mellitus (NIDDM). Alternative splicing results in multiple transcript variants of this gene. [provided by RefSeq, Jul 2013]
PHENOTYPE: Homozygous null mice are hyperglycemic with hypoinsulinemia and die within 2-3 weeks of life displaying increased plasma levels of glucagon, free fatty acids and beta-hydroxybutyrate, abnormal glucose tolerance, and altered postnatal development of pancreatic islets. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts3 T C 5: 90,009,256 (GRCm39) S136G probably benign Het
Apba3 T A 10: 81,108,180 (GRCm39) N445K probably damaging Het
Aqp6 A G 15: 99,501,652 (GRCm39) K237E possibly damaging Het
Arhgap23 A G 11: 97,391,169 (GRCm39) T1229A probably benign Het
Bpifb1 T C 2: 154,056,071 (GRCm39) I379T probably damaging Het
Bpnt2 G A 4: 4,778,207 (GRCm39) T177I probably damaging Het
Ccdc169 A G 3: 55,047,530 (GRCm39) D7G probably damaging Het
Cyp2f2 T A 7: 26,830,784 (GRCm39) probably null Het
Daam2 T A 17: 49,787,755 (GRCm39) K453* probably null Het
Dennd4c T C 4: 86,729,849 (GRCm39) L817P probably damaging Het
Efcab6 T A 15: 83,755,189 (GRCm39) R1376W probably damaging Het
Esrra G T 19: 6,891,214 (GRCm39) A182E possibly damaging Het
Fam234b T A 6: 135,203,874 (GRCm39) V392E probably damaging Het
Fanca A G 8: 123,997,999 (GRCm39) V1229A probably benign Het
Fdps G T 3: 89,006,693 (GRCm39) Q66K probably benign Het
Fer1l6 T A 15: 58,499,438 (GRCm39) D1269E probably benign Het
Foxred1 G A 9: 35,116,932 (GRCm39) R353W probably damaging Het
Gabrg2 C T 11: 41,858,451 (GRCm39) V226I possibly damaging Het
Gcnt2 C A 13: 41,014,343 (GRCm39) C171* probably null Het
Glyat C A 19: 12,617,172 (GRCm39) A8E probably damaging Het
Golgb1 C A 16: 36,695,758 (GRCm39) R86S unknown Het
Hc T A 2: 34,940,431 (GRCm39) T136S probably damaging Het
Hdac1 G T 4: 129,411,259 (GRCm39) S421* probably null Het
Hmcn2 G T 2: 31,246,298 (GRCm39) A756S possibly damaging Het
Igkv8-26 A G 6: 70,170,571 (GRCm39) N54S probably benign Het
Itgae T A 11: 73,012,786 (GRCm39) V706E possibly damaging Het
Itgax G A 7: 127,747,262 (GRCm39) V992M probably damaging Het
Klk10 A G 7: 43,433,851 (GRCm39) D221G probably benign Het
Klkb1 T C 8: 45,731,150 (GRCm39) I205V probably benign Het
Kpna2 T C 11: 106,889,583 (GRCm39) N8S probably null Het
L3mbtl1 A C 2: 162,806,434 (GRCm39) T442P possibly damaging Het
Lrp1b C T 2: 40,551,561 (GRCm39) C4181Y Het
Mcat T C 15: 83,431,872 (GRCm39) Y332C probably damaging Het
Mecom T C 3: 30,010,534 (GRCm39) D648G probably damaging Het
Mesp2 A T 7: 79,460,717 (GRCm39) D14V probably damaging Het
Mlh3 A T 12: 85,314,973 (GRCm39) Y404* probably null Het
Mterf3 A T 13: 67,065,212 (GRCm39) F230I probably damaging Het
Nrxn3 T C 12: 89,478,832 (GRCm39) V602A probably benign Het
Or4a74 T A 2: 89,439,571 (GRCm39) I292F possibly damaging Het
Plekhg6 A G 6: 125,351,623 (GRCm39) F209L probably damaging Het
Pmp22 C A 11: 63,049,174 (GRCm39) A139D probably damaging Het
Polr2e T C 10: 79,874,404 (GRCm39) D34G possibly damaging Het
Ppard T A 17: 28,516,091 (GRCm39) L105H probably damaging Het
Ptpn14 T A 1: 189,582,942 (GRCm39) D596E probably benign Het
Ptprz1 C T 6: 23,002,518 (GRCm39) A1536V not run Het
Qng1 T A 13: 58,529,649 (GRCm39) H321L probably damaging Het
Rabgap1 TGGGG TGGG 2: 37,392,908 (GRCm39) probably null Het
Retreg1 T A 15: 25,971,727 (GRCm39) D222E probably benign Het
Rmnd1 T C 10: 4,363,404 (GRCm39) K282R probably benign Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,229,111 (GRCm39) probably benign Het
Sall3 C T 18: 81,015,267 (GRCm39) R887H possibly damaging Het
Samd3 A G 10: 26,139,711 (GRCm39) D281G probably benign Het
Scube1 T A 15: 83,497,653 (GRCm39) D766V probably damaging Het
Sec24b TGC TGCAGC 3: 129,834,460 (GRCm39) probably benign Het
Slc39a2 A T 14: 52,132,488 (GRCm39) T144S probably benign Het
Slc5a9 T C 4: 111,734,937 (GRCm39) H619R probably benign Het
Slco4a1 T C 2: 180,113,048 (GRCm39) F427L probably benign Het
Snapc3 C A 4: 83,336,073 (GRCm39) Y28* probably null Het
St3gal6 C T 16: 58,293,800 (GRCm39) R243H probably benign Het
Stat2 T A 10: 128,113,066 (GRCm39) N119K possibly damaging Het
Syne2 G C 12: 76,013,145 (GRCm39) V2779L probably benign Het
Tacc1 T A 8: 25,691,301 (GRCm39) M1L probably damaging Het
Tbc1d32 A T 10: 56,027,929 (GRCm39) F724L possibly damaging Het
Ttc23l A G 15: 10,533,766 (GRCm39) I259T possibly damaging Het
Ucn2 T C 9: 108,815,292 (GRCm39) I18T probably benign Het
Wdr35 G C 12: 9,074,886 (GRCm39) A1000P probably benign Het
Wnk1 C A 6: 119,906,789 (GRCm39) C244F possibly damaging Het
Zeb2 T G 2: 44,884,625 (GRCm39) D1022A probably damaging Het
Zfp26 A T 9: 20,349,129 (GRCm39) H478Q probably damaging Het
Zfp410 A G 12: 84,378,630 (GRCm39) K265R probably benign Het
Zfp575 T C 7: 24,286,093 (GRCm39) D21G probably benign Het
Other mutations in Slc2a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00836:Slc2a2 APN 3 28,772,890 (GRCm39) missense possibly damaging 0.86
IGL01582:Slc2a2 APN 3 28,762,637 (GRCm39) missense probably benign 0.01
IGL01762:Slc2a2 APN 3 28,771,621 (GRCm39) missense probably damaging 1.00
IGL01942:Slc2a2 APN 3 28,759,952 (GRCm39) missense probably damaging 1.00
IGL02128:Slc2a2 APN 3 28,773,550 (GRCm39) missense probably damaging 1.00
IGL02218:Slc2a2 APN 3 28,752,174 (GRCm39) missense possibly damaging 0.94
IGL02278:Slc2a2 APN 3 28,771,604 (GRCm39) missense probably damaging 0.99
IGL02507:Slc2a2 APN 3 28,781,260 (GRCm39) missense probably benign 0.00
IGL02649:Slc2a2 APN 3 28,772,885 (GRCm39) missense probably damaging 0.97
IGL03323:Slc2a2 APN 3 28,780,439 (GRCm39) missense probably damaging 1.00
IGL03147:Slc2a2 UTSW 3 28,773,519 (GRCm39) missense possibly damaging 0.56
R0063:Slc2a2 UTSW 3 28,771,589 (GRCm39) missense probably damaging 0.98
R0063:Slc2a2 UTSW 3 28,771,589 (GRCm39) missense probably damaging 0.98
R0365:Slc2a2 UTSW 3 28,762,828 (GRCm39) critical splice donor site probably null
R0494:Slc2a2 UTSW 3 28,781,426 (GRCm39) missense probably benign 0.01
R0519:Slc2a2 UTSW 3 28,772,965 (GRCm39) missense possibly damaging 0.54
R1292:Slc2a2 UTSW 3 28,771,637 (GRCm39) missense probably damaging 1.00
R1755:Slc2a2 UTSW 3 28,767,811 (GRCm39) splice site probably null
R1965:Slc2a2 UTSW 3 28,773,634 (GRCm39) missense probably damaging 1.00
R1966:Slc2a2 UTSW 3 28,773,634 (GRCm39) missense probably damaging 1.00
R1982:Slc2a2 UTSW 3 28,771,590 (GRCm39) missense probably benign 0.36
R2937:Slc2a2 UTSW 3 28,772,920 (GRCm39) missense probably damaging 1.00
R3121:Slc2a2 UTSW 3 28,775,898 (GRCm39) missense probably benign 0.01
R3721:Slc2a2 UTSW 3 28,781,301 (GRCm39) missense probably damaging 1.00
R4799:Slc2a2 UTSW 3 28,771,681 (GRCm39) critical splice donor site probably null
R5206:Slc2a2 UTSW 3 28,762,756 (GRCm39) missense probably damaging 1.00
R6829:Slc2a2 UTSW 3 28,781,590 (GRCm39) nonsense probably null
R6864:Slc2a2 UTSW 3 28,775,874 (GRCm39) missense probably damaging 1.00
R6932:Slc2a2 UTSW 3 28,771,668 (GRCm39) missense probably benign 0.40
R7178:Slc2a2 UTSW 3 28,773,631 (GRCm39) missense possibly damaging 0.90
R7616:Slc2a2 UTSW 3 28,781,260 (GRCm39) missense probably benign 0.00
R8879:Slc2a2 UTSW 3 28,767,951 (GRCm39) missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- CTCAAGCCACAAGTCATTGGG -3'
(R):5'- GTCCGATTACTGAATAAGAACATGG -3'

Sequencing Primer
(F):5'- AAGGGTGTATTGATTGGATTACCATC -3'
(R):5'- GCGTATAAGTTCACTGCC -3'
Posted On 2019-10-24