Mutagenetix > Incidental Mutation

Incidental Mutation 'R7599:Sec24b'

587887

Institutional Source

Beutler Lab

Gene Symbol

Sec24b

Ensembl Gene

ENSMUSG00000001052

Gene Name

Sec24 related gene family, member B (S. cerevisiae)

Synonyms

SEC24

MMRRC Submission

Accession Numbers

Essential gene?

Probably essential (E-score: 0.798) question?

Stock #

R7599 (G1)

Quality Score

148.467

Status

Not validated

Chromosome

Chromosomal Location

129982759-130061553 bp(-) (GRCm38)

Type of Mutation

small insertion (1 aa in frame mutation)

DNA Base Change (assembly)

TGC to TGCAGC at 130040811 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000126923 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000001079] [ENSMUST00000165873] [ENSMUST00000168644]

AlphaFold

Q80ZX0

Predicted Effect

probably benign
Transcript: ENSMUST00000001079

SMART Domains

Protein: ENSMUSP00000001079
Gene: ENSMUSG00000001052

Domain	Start	End	E-Value	Type
low complexity region	2	14	N/A	INTRINSIC
low complexity region	127	143	N/A	INTRINSIC
low complexity region	229	254	N/A	INTRINSIC
low complexity region	316	333	N/A	INTRINSIC
low complexity region	351	362	N/A	INTRINSIC
low complexity region	363	373	N/A	INTRINSIC
low complexity region	378	386	N/A	INTRINSIC
low complexity region	419	444	N/A	INTRINSIC
low complexity region	450	473	N/A	INTRINSIC
low complexity region	486	505	N/A	INTRINSIC
low complexity region	555	568	N/A	INTRINSIC
Pfam:zf-Sec23_Sec24	585	622	4.1e-17	PFAM
Pfam:Sec23_trunk	658	897	2.4e-87	PFAM
Pfam:Sec23_BS	902	986	3.4e-23	PFAM
Pfam:Sec23_helical	999	1099	8.7e-31	PFAM
Pfam:Gelsolin	1122	1197	4.9e-13	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000165873

SMART Domains

Protein: ENSMUSP00000132861
Gene: ENSMUSG00000001052

Domain	Start	End	E-Value	Type
low complexity region	1	26	N/A	INTRINSIC
low complexity region	88	105	N/A	INTRINSIC
low complexity region	115	123	N/A	INTRINSIC
low complexity region	156	181	N/A	INTRINSIC
low complexity region	187	210	N/A	INTRINSIC
low complexity region	223	242	N/A	INTRINSIC
low complexity region	292	305	N/A	INTRINSIC
Pfam:zf-Sec23_Sec24	321	359	2.5e-18	PFAM
Pfam:Sec23_trunk	395	634	1.6e-87	PFAM
Pfam:Sec23_BS	639	723	2.2e-23	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000168644

SMART Domains

Protein: ENSMUSP00000126923
Gene: ENSMUSG00000001052

Domain	Start	End	E-Value	Type
low complexity region	93	118	N/A	INTRINSIC
low complexity region	180	197	N/A	INTRINSIC
low complexity region	249	257	N/A	INTRINSIC
low complexity region	290	315	N/A	INTRINSIC
low complexity region	321	344	N/A	INTRINSIC
low complexity region	357	376	N/A	INTRINSIC
PDB:3EH1\|A	377	411	1e-11	PDB

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SEC24 subfamily of the SEC23/SEC24 family, which is involved in vesicle trafficking. The encoded protein is thought to be a cargo-binding component of the COPII vesicle, and is thought to be involved in the transport of secretory proteins from the endoplasmic reticulum to the Golgi apparatus. Mutations in this gene have been associated with neural tube defects, and are thought to be a result of a disruption in interactions with the protein encoded by the VANGL planar cell polarity protein 2 (VANGL2) gene. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for an ENU induced mutation exhibit craniorachischisis, abnormal embryo shape, omphalocele, disoriented hair cells, and failure of eyelid fusion. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2210016F16Rik	T	A	13: 58,381,835	H321L	probably damaging	Het
Adamts3	T	C	5: 89,861,397	S136G	probably benign	Het
Apba3	T	A	10: 81,272,346	N445K	probably damaging	Het
Aqp6	A	G	15: 99,603,771	K237E	possibly damaging	Het
Arhgap23	A	G	11: 97,500,343	T1229A	probably benign	Het
Bpifb1	T	C	2: 154,214,151	I379T	probably damaging	Het
Ccdc169	A	G	3: 55,140,109	D7G	probably damaging	Het
Cyp2f2	T	A	7: 27,131,359		probably null	Het
Daam2	T	A	17: 49,480,727	K453*	probably null	Het
Dennd4c	T	C	4: 86,811,612	L817P	probably damaging	Het
Efcab6	T	A	15: 83,870,988	R1376W	probably damaging	Het
Esrra	G	T	19: 6,913,846	A182E	possibly damaging	Het
Fam234b	T	A	6: 135,226,876	V392E	probably damaging	Het
Fanca	A	G	8: 123,271,260	V1229A	probably benign	Het
Fdps	G	T	3: 89,099,386	Q66K	probably benign	Het
Fer1l6	T	A	15: 58,627,589	D1269E	probably benign	Het
Foxred1	G	A	9: 35,205,636	R353W	probably damaging	Het
Gabrg2	C	T	11: 41,967,624	V226I	possibly damaging	Het
Gcnt2	C	A	13: 40,860,867	C171*	probably null	Het
Glyat	C	A	19: 12,639,808	A8E	probably damaging	Het
Golgb1	C	A	16: 36,875,396	R86S	unknown	Het
Hc	T	A	2: 35,050,419	T136S	probably damaging	Het
Hdac1	G	T	4: 129,517,466	S421*	probably null	Het
Hmcn2	G	T	2: 31,356,286	A756S	possibly damaging	Het
Igkv8-26	A	G	6: 70,193,587	N54S	probably benign	Het
Impad1	G	A	4: 4,778,207	T177I	probably damaging	Het
Itgae	T	A	11: 73,121,960	V706E	possibly damaging	Het
Itgax	G	A	7: 128,148,090	V992M	probably damaging	Het
Klk10	A	G	7: 43,784,427	D221G	probably benign	Het
Klkb1	T	C	8: 45,278,113	I205V	probably benign	Het
Kpna2	T	C	11: 106,998,757	N8S	probably null	Het
L3mbtl1	A	C	2: 162,964,514	T442P	possibly damaging	Het
Lrp1b	C	T	2: 40,661,549	C4181Y		Het
Mcat	T	C	15: 83,547,671	Y332C	probably damaging	Het
Mecom	T	C	3: 29,956,385	D648G	probably damaging	Het
Mesp2	A	T	7: 79,810,969	D14V	probably damaging	Het
Mlh3	A	T	12: 85,268,199	Y404*	probably null	Het
Mterf3	A	T	13: 66,917,148	F230I	probably damaging	Het
Nrxn3	T	C	12: 89,512,062	V602A	probably benign	Het
Olfr1247	T	A	2: 89,609,227	I292F	possibly damaging	Het
Plekhg6	A	G	6: 125,374,660	F209L	probably damaging	Het
Pmp22	C	A	11: 63,158,348	A139D	probably damaging	Het
Polr2e	T	C	10: 80,038,570	D34G	possibly damaging	Het
Ppard	T	A	17: 28,297,117	L105H	probably damaging	Het
Ptpn14	T	A	1: 189,850,745	D596E	probably benign	Het
Ptprz1	C	T	6: 23,002,519	A1536V	not run	Het
Rabgap1	TGGGG	TGGG	2: 37,502,896		probably null	Het
Retreg1	T	A	15: 25,971,641	D222E	probably benign	Het
Rmnd1	T	C	10: 4,413,404	K282R	probably benign	Het
Rsf1	ATGGCG	ATGGCGACGGTGGCG	7: 97,579,904		probably benign	Het
Sall3	C	T	18: 80,972,052	R887H	possibly damaging	Het
Samd3	A	G	10: 26,263,813	D281G	probably benign	Het
Scube1	T	A	15: 83,613,452	D766V	probably damaging	Het
Slc2a2	A	G	3: 28,698,017	M1V	probably null	Het
Slc39a2	A	T	14: 51,895,031	T144S	probably benign	Het
Slc5a9	T	C	4: 111,877,740	H619R	probably benign	Het
Slco4a1	T	C	2: 180,471,255	F427L	probably benign	Het
Snapc3	C	A	4: 83,417,836	Y28*	probably null	Het
St3gal6	C	T	16: 58,473,437	R243H	probably benign	Het
Stat2	T	A	10: 128,277,197	N119K	possibly damaging	Het
Syne2	G	C	12: 75,966,371	V2779L	probably benign	Het
Tacc1	T	A	8: 25,201,285	M1L	probably damaging	Het
Tbc1d32	A	T	10: 56,151,833	F724L	possibly damaging	Het
Ttc23l	A	G	15: 10,533,680	I259T	possibly damaging	Het
Ucn2	T	C	9: 108,986,224	I18T	probably benign	Het
Wdr35	G	C	12: 9,024,886	A1000P	probably benign	Het
Wnk1	C	A	6: 119,929,828	C244F	possibly damaging	Het
Zeb2	T	G	2: 44,994,613	D1022A	probably damaging	Het
Zfp26	A	T	9: 20,437,833	H478Q	probably damaging	Het
Zfp410	A	G	12: 84,331,856	K265R	probably benign	Het
Zfp575	T	C	7: 24,586,668	D21G	probably benign	Het

Other mutations in Sec24b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00984:Sec24b	APN	3	130020646	intron	probably benign
IGL01137:Sec24b	APN	3	130007444	missense	probably benign	0.02
IGL01370:Sec24b	APN	3	130007604	splice site	probably benign
IGL01931:Sec24b	APN	3	130009799	missense	probably benign	0.00
PIT4696001:Sec24b	UTSW	3	129994391	missense	probably benign	0.01
R0193:Sec24b	UTSW	3	129988984	missense	probably null
R0194:Sec24b	UTSW	3	129984165	critical splice donor site	probably null
R0403:Sec24b	UTSW	3	129989676	missense	possibly damaging	0.81
R0403:Sec24b	UTSW	3	129999534	missense	probably damaging	1.00
R0576:Sec24b	UTSW	3	130041336	missense	probably benign	0.11
R0583:Sec24b	UTSW	3	130041311	nonsense	probably null
R0963:Sec24b	UTSW	3	130040905	missense	probably benign	0.02
R0967:Sec24b	UTSW	3	129996782	missense	probably damaging	1.00
R1344:Sec24b	UTSW	3	130007423	missense	probably damaging	1.00
R1418:Sec24b	UTSW	3	130007423	missense	probably damaging	1.00
R1594:Sec24b	UTSW	3	129991351	missense	probably benign	0.00
R1716:Sec24b	UTSW	3	130041016	missense	possibly damaging	0.89
R1938:Sec24b	UTSW	3	129991361	missense	possibly damaging	0.82
R2020:Sec24b	UTSW	3	129987728	missense	probably damaging	1.00
R2407:Sec24b	UTSW	3	130002316	missense	probably benign	0.02
R2415:Sec24b	UTSW	3	129996080	missense	probably benign	0.00
R3121:Sec24b	UTSW	3	130002304	critical splice donor site	probably null
R3729:Sec24b	UTSW	3	130033833	missense	possibly damaging	0.95
R3731:Sec24b	UTSW	3	130033833	missense	possibly damaging	0.95
R3789:Sec24b	UTSW	3	130020627	missense	probably benign	0.00
R4229:Sec24b	UTSW	3	130040719	missense	probably benign	0.24
R4230:Sec24b	UTSW	3	130040719	missense	probably benign	0.24
R4617:Sec24b	UTSW	3	130040764	missense	possibly damaging	0.94
R4856:Sec24b	UTSW	3	129983970	missense	probably benign	0.07
R4886:Sec24b	UTSW	3	129983970	missense	probably benign	0.07
R4913:Sec24b	UTSW	3	130002379	missense	probably benign	0.07
R5510:Sec24b	UTSW	3	130040895	missense	probably damaging	1.00
R5601:Sec24b	UTSW	3	130040834	small insertion	probably benign
R6167:Sec24b	UTSW	3	129988901	missense	possibly damaging	0.88
R6314:Sec24b	UTSW	3	130007245	splice site	probably null
R6442:Sec24b	UTSW	3	129996701	missense	probably damaging	1.00
R6512:Sec24b	UTSW	3	130041297	missense	probably damaging	1.00
R6743:Sec24b	UTSW	3	130041232	missense	probably damaging	0.98
R7081:Sec24b	UTSW	3	129987742	missense	probably benign	0.00
R7179:Sec24b	UTSW	3	129988946	missense	probably damaging	1.00
R7214:Sec24b	UTSW	3	130033860	missense	probably benign	0.19
R7332:Sec24b	UTSW	3	130041393	missense	probably benign	0.10
R7414:Sec24b	UTSW	3	130009865	missense	probably benign	0.01
R7774:Sec24b	UTSW	3	129984197	missense	possibly damaging	0.88
R7895:Sec24b	UTSW	3	129995949	missense	probably benign	0.13
R8146:Sec24b	UTSW	3	129995924	nonsense	probably null
R8217:Sec24b	UTSW	3	130040950	missense	possibly damaging	0.94
R8344:Sec24b	UTSW	3	130005001	missense	probably damaging	0.97
R8525:Sec24b	UTSW	3	130011818	missense	probably damaging	1.00
R8699:Sec24b	UTSW	3	130005004	missense	probably damaging	1.00
R8783:Sec24b	UTSW	3	129989693	missense	probably benign
R8929:Sec24b	UTSW	3	130009858	missense	possibly damaging	0.80
R8967:Sec24b	UTSW	3	129991435	missense	probably damaging	1.00
R9332:Sec24b	UTSW	3	130007571	missense	probably benign	0.01
R9355:Sec24b	UTSW	3	129993840	missense	possibly damaging	0.60
R9660:Sec24b	UTSW	3	129996773	missense	probably damaging	1.00
R9728:Sec24b	UTSW	3	129996773	missense	probably damaging	1.00
R9781:Sec24b	UTSW	3	129996093	missense	probably damaging	0.98
X0065:Sec24b	UTSW	3	129996355	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GACTGTCAGTCCTGTTCTGG -3'
(R):5'- ACGTACTCTGCCAATGCTTC -3'

Sequencing Primer
(F):5'- AGTCCTGTTCTGGTGAATTTCATAC -3'
(R):5'- CATCTCAACTGTGTCTAATGTGG -3'

Posted On

2019-10-24