Incidental Mutation 'R7599:Klkb1'
ID 587906
Institutional Source Beutler Lab
Gene Symbol Klkb1
Ensembl Gene ENSMUSG00000109764
Gene Name kallikrein B, plasma 1
Synonyms PSA, Kal3, Klk3, Kal-3
MMRRC Submission 045673-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7599 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 45719725-45747872 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 45731150 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 205 (I205V)
Ref Sequence ENSEMBL: ENSMUSP00000026907 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026907]
AlphaFold P26262
Predicted Effect probably benign
Transcript: ENSMUST00000026907
AA Change: I205V

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000026907
Gene: ENSMUSG00000109764
AA Change: I205V

DomainStartEndE-ValueType
APPLE 21 104 1.96e-40 SMART
APPLE 111 194 3.93e-40 SMART
APPLE 201 284 2.65e-37 SMART
APPLE 292 375 1.34e-33 SMART
Tryp_SPc 390 621 2.22e-99 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000116473
SMART Domains Protein: ENSMUSP00000112174
Gene: ENSMUSG00000031640

DomainStartEndE-ValueType
APPLE 21 104 1.96e-40 SMART
APPLE 111 194 3.93e-40 SMART
APPLE 201 284 2.65e-37 SMART
APPLE 292 375 1.34e-33 SMART
Tryp_SPc 390 621 2.22e-99 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the kallikrein subfamily of serine proteases that are involved in diverse physiological functions such as skin desquamation, tooth enamel formation, seminal liquefaction, synaptic neural plasticity and brain function. The encoded preproprotein undergoes proteolytic processing to generate a disulfide-linked heterodimeric enzyme comprised of heavy and light chains. A complete deletion of the encoded protein prevents occlusive thrombus formation in mice with a minimal role in provoked bleeding. [provided by RefSeq, May 2016]
PHENOTYPE: Homozygous inactivation of this gene leads to reduced hematoma expansion in streptozotocin-induced diabetic mice subjected to autologous blood injection, and prolonged activated partial thromboplastin time. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts3 T C 5: 90,009,256 (GRCm39) S136G probably benign Het
Apba3 T A 10: 81,108,180 (GRCm39) N445K probably damaging Het
Aqp6 A G 15: 99,501,652 (GRCm39) K237E possibly damaging Het
Arhgap23 A G 11: 97,391,169 (GRCm39) T1229A probably benign Het
Bpifb1 T C 2: 154,056,071 (GRCm39) I379T probably damaging Het
Bpnt2 G A 4: 4,778,207 (GRCm39) T177I probably damaging Het
Ccdc169 A G 3: 55,047,530 (GRCm39) D7G probably damaging Het
Cyp2f2 T A 7: 26,830,784 (GRCm39) probably null Het
Daam2 T A 17: 49,787,755 (GRCm39) K453* probably null Het
Dennd4c T C 4: 86,729,849 (GRCm39) L817P probably damaging Het
Efcab6 T A 15: 83,755,189 (GRCm39) R1376W probably damaging Het
Esrra G T 19: 6,891,214 (GRCm39) A182E possibly damaging Het
Fam234b T A 6: 135,203,874 (GRCm39) V392E probably damaging Het
Fanca A G 8: 123,997,999 (GRCm39) V1229A probably benign Het
Fdps G T 3: 89,006,693 (GRCm39) Q66K probably benign Het
Fer1l6 T A 15: 58,499,438 (GRCm39) D1269E probably benign Het
Foxred1 G A 9: 35,116,932 (GRCm39) R353W probably damaging Het
Gabrg2 C T 11: 41,858,451 (GRCm39) V226I possibly damaging Het
Gcnt2 C A 13: 41,014,343 (GRCm39) C171* probably null Het
Glyat C A 19: 12,617,172 (GRCm39) A8E probably damaging Het
Golgb1 C A 16: 36,695,758 (GRCm39) R86S unknown Het
Hc T A 2: 34,940,431 (GRCm39) T136S probably damaging Het
Hdac1 G T 4: 129,411,259 (GRCm39) S421* probably null Het
Hmcn2 G T 2: 31,246,298 (GRCm39) A756S possibly damaging Het
Igkv8-26 A G 6: 70,170,571 (GRCm39) N54S probably benign Het
Itgae T A 11: 73,012,786 (GRCm39) V706E possibly damaging Het
Itgax G A 7: 127,747,262 (GRCm39) V992M probably damaging Het
Klk10 A G 7: 43,433,851 (GRCm39) D221G probably benign Het
Kpna2 T C 11: 106,889,583 (GRCm39) N8S probably null Het
L3mbtl1 A C 2: 162,806,434 (GRCm39) T442P possibly damaging Het
Lrp1b C T 2: 40,551,561 (GRCm39) C4181Y Het
Mcat T C 15: 83,431,872 (GRCm39) Y332C probably damaging Het
Mecom T C 3: 30,010,534 (GRCm39) D648G probably damaging Het
Mesp2 A T 7: 79,460,717 (GRCm39) D14V probably damaging Het
Mlh3 A T 12: 85,314,973 (GRCm39) Y404* probably null Het
Mterf3 A T 13: 67,065,212 (GRCm39) F230I probably damaging Het
Nrxn3 T C 12: 89,478,832 (GRCm39) V602A probably benign Het
Or4a74 T A 2: 89,439,571 (GRCm39) I292F possibly damaging Het
Plekhg6 A G 6: 125,351,623 (GRCm39) F209L probably damaging Het
Pmp22 C A 11: 63,049,174 (GRCm39) A139D probably damaging Het
Polr2e T C 10: 79,874,404 (GRCm39) D34G possibly damaging Het
Ppard T A 17: 28,516,091 (GRCm39) L105H probably damaging Het
Ptpn14 T A 1: 189,582,942 (GRCm39) D596E probably benign Het
Ptprz1 C T 6: 23,002,518 (GRCm39) A1536V not run Het
Qng1 T A 13: 58,529,649 (GRCm39) H321L probably damaging Het
Rabgap1 TGGGG TGGG 2: 37,392,908 (GRCm39) probably null Het
Retreg1 T A 15: 25,971,727 (GRCm39) D222E probably benign Het
Rmnd1 T C 10: 4,363,404 (GRCm39) K282R probably benign Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,229,111 (GRCm39) probably benign Het
Sall3 C T 18: 81,015,267 (GRCm39) R887H possibly damaging Het
Samd3 A G 10: 26,139,711 (GRCm39) D281G probably benign Het
Scube1 T A 15: 83,497,653 (GRCm39) D766V probably damaging Het
Sec24b TGC TGCAGC 3: 129,834,460 (GRCm39) probably benign Het
Slc2a2 A G 3: 28,752,166 (GRCm39) M1V probably null Het
Slc39a2 A T 14: 52,132,488 (GRCm39) T144S probably benign Het
Slc5a9 T C 4: 111,734,937 (GRCm39) H619R probably benign Het
Slco4a1 T C 2: 180,113,048 (GRCm39) F427L probably benign Het
Snapc3 C A 4: 83,336,073 (GRCm39) Y28* probably null Het
St3gal6 C T 16: 58,293,800 (GRCm39) R243H probably benign Het
Stat2 T A 10: 128,113,066 (GRCm39) N119K possibly damaging Het
Syne2 G C 12: 76,013,145 (GRCm39) V2779L probably benign Het
Tacc1 T A 8: 25,691,301 (GRCm39) M1L probably damaging Het
Tbc1d32 A T 10: 56,027,929 (GRCm39) F724L possibly damaging Het
Ttc23l A G 15: 10,533,766 (GRCm39) I259T possibly damaging Het
Ucn2 T C 9: 108,815,292 (GRCm39) I18T probably benign Het
Wdr35 G C 12: 9,074,886 (GRCm39) A1000P probably benign Het
Wnk1 C A 6: 119,906,789 (GRCm39) C244F possibly damaging Het
Zeb2 T G 2: 44,884,625 (GRCm39) D1022A probably damaging Het
Zfp26 A T 9: 20,349,129 (GRCm39) H478Q probably damaging Het
Zfp410 A G 12: 84,378,630 (GRCm39) K265R probably benign Het
Zfp575 T C 7: 24,286,093 (GRCm39) D21G probably benign Het
Other mutations in Klkb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00979:Klkb1 APN 8 45,747,105 (GRCm39) splice site probably benign
IGL01756:Klkb1 APN 8 45,725,361 (GRCm39) missense probably damaging 0.99
IGL01783:Klkb1 APN 8 45,729,428 (GRCm39) missense probably damaging 1.00
IGL01809:Klkb1 APN 8 45,729,090 (GRCm39) missense probably benign 0.00
IGL02128:Klkb1 APN 8 45,740,068 (GRCm39) missense probably damaging 1.00
IGL02512:Klkb1 APN 8 45,729,277 (GRCm39) splice site probably benign
E0374:Klkb1 UTSW 8 45,742,128 (GRCm39) missense possibly damaging 0.58
R0048:Klkb1 UTSW 8 45,742,233 (GRCm39) splice site probably benign
R0149:Klkb1 UTSW 8 45,729,100 (GRCm39) missense probably damaging 1.00
R0278:Klkb1 UTSW 8 45,725,446 (GRCm39) missense probably benign 0.27
R0551:Klkb1 UTSW 8 45,731,003 (GRCm39) critical splice donor site probably null
R1103:Klkb1 UTSW 8 45,729,183 (GRCm39) missense probably damaging 1.00
R1420:Klkb1 UTSW 8 45,729,183 (GRCm39) missense probably damaging 1.00
R1930:Klkb1 UTSW 8 45,728,514 (GRCm39) missense probably benign 0.13
R1931:Klkb1 UTSW 8 45,728,514 (GRCm39) missense probably benign 0.13
R2125:Klkb1 UTSW 8 45,728,541 (GRCm39) missense possibly damaging 0.68
R2418:Klkb1 UTSW 8 45,742,149 (GRCm39) missense possibly damaging 0.86
R2419:Klkb1 UTSW 8 45,742,149 (GRCm39) missense possibly damaging 0.86
R3938:Klkb1 UTSW 8 45,735,838 (GRCm39) missense probably damaging 0.99
R4445:Klkb1 UTSW 8 45,730,092 (GRCm39) missense probably benign 0.11
R4461:Klkb1 UTSW 8 45,726,612 (GRCm39) missense probably damaging 1.00
R4969:Klkb1 UTSW 8 45,735,814 (GRCm39) missense probably benign 0.43
R4974:Klkb1 UTSW 8 45,739,995 (GRCm39) missense probably damaging 1.00
R5113:Klkb1 UTSW 8 45,723,734 (GRCm39) missense probably benign 0.00
R5117:Klkb1 UTSW 8 45,742,149 (GRCm39) missense possibly damaging 0.86
R5339:Klkb1 UTSW 8 45,723,748 (GRCm39) missense possibly damaging 0.93
R5891:Klkb1 UTSW 8 45,723,703 (GRCm39) missense probably benign 0.13
R6230:Klkb1 UTSW 8 45,736,252 (GRCm39) missense probably benign 0.03
R6554:Klkb1 UTSW 8 45,726,591 (GRCm39) missense probably damaging 1.00
R6564:Klkb1 UTSW 8 45,726,671 (GRCm39) missense probably damaging 0.98
R7130:Klkb1 UTSW 8 45,728,575 (GRCm39) missense probably benign 0.00
R7497:Klkb1 UTSW 8 45,747,827 (GRCm39) utr 3 prime probably benign
R7867:Klkb1 UTSW 8 45,740,002 (GRCm39) missense probably damaging 1.00
R9087:Klkb1 UTSW 8 45,728,515 (GRCm39) nonsense probably null
R9254:Klkb1 UTSW 8 45,742,067 (GRCm39) missense probably benign 0.00
R9311:Klkb1 UTSW 8 45,722,983 (GRCm39) missense probably benign 0.09
R9393:Klkb1 UTSW 8 45,729,392 (GRCm39) missense probably benign 0.33
R9522:Klkb1 UTSW 8 45,730,052 (GRCm39) missense probably benign 0.02
R9756:Klkb1 UTSW 8 45,735,811 (GRCm39) missense possibly damaging 0.95
Z1176:Klkb1 UTSW 8 45,726,666 (GRCm39) missense probably damaging 0.99
Z1177:Klkb1 UTSW 8 45,728,509 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCTCGCAAGGAACGGAAAG -3'
(R):5'- AGGCTTTCCTCCTCTTATTGAAATG -3'

Sequencing Primer
(F):5'- GGGCTAGAAGGGGGCGC -3'
(R):5'- ATAGTCAAGTGGAAGCTATACCC -3'
Posted On 2019-10-24