Incidental Mutation 'R7599:Klkb1'
ID587906
Institutional Source Beutler Lab
Gene Symbol Klkb1
Ensembl Gene ENSMUSG00000109764
Gene Namekallikrein B, plasma 1
SynonymsKlk3, Kal-3, PSA, Kal3
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7599 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location45266689-45294859 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 45278113 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 205 (I205V)
Ref Sequence ENSEMBL: ENSMUSP00000026907 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026907]
Predicted Effect probably benign
Transcript: ENSMUST00000026907
AA Change: I205V

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000026907
Gene: ENSMUSG00000109764
AA Change: I205V

DomainStartEndE-ValueType
APPLE 21 104 1.96e-40 SMART
APPLE 111 194 3.93e-40 SMART
APPLE 201 284 2.65e-37 SMART
APPLE 292 375 1.34e-33 SMART
Tryp_SPc 390 621 2.22e-99 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000116473
SMART Domains Protein: ENSMUSP00000112174
Gene: ENSMUSG00000031640

DomainStartEndE-ValueType
APPLE 21 104 1.96e-40 SMART
APPLE 111 194 3.93e-40 SMART
APPLE 201 284 2.65e-37 SMART
APPLE 292 375 1.34e-33 SMART
Tryp_SPc 390 621 2.22e-99 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the kallikrein subfamily of serine proteases that are involved in diverse physiological functions such as skin desquamation, tooth enamel formation, seminal liquefaction, synaptic neural plasticity and brain function. The encoded preproprotein undergoes proteolytic processing to generate a disulfide-linked heterodimeric enzyme comprised of heavy and light chains. A complete deletion of the encoded protein prevents occlusive thrombus formation in mice with a minimal role in provoked bleeding. [provided by RefSeq, May 2016]
PHENOTYPE: Homozygous inactivation of this gene leads to reduced hematoma expansion in streptozotocin-induced diabetic mice subjected to autologous blood injection, and prolonged activated partial thromboplastin time. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210016F16Rik T A 13: 58,381,835 H321L probably damaging Het
Adamts3 T C 5: 89,861,397 S136G probably benign Het
Apba3 T A 10: 81,272,346 N445K probably damaging Het
Aqp6 A G 15: 99,603,771 K237E possibly damaging Het
Arhgap23 A G 11: 97,500,343 T1229A probably benign Het
Bpifb1 T C 2: 154,214,151 I379T probably damaging Het
Ccdc169 A G 3: 55,140,109 D7G probably damaging Het
Cyp2f2 T A 7: 27,131,359 probably null Het
Daam2 T A 17: 49,480,727 K453* probably null Het
Dennd4c T C 4: 86,811,612 L817P probably damaging Het
Efcab6 T A 15: 83,870,988 R1376W probably damaging Het
Esrra G T 19: 6,913,846 A182E possibly damaging Het
Fam234b T A 6: 135,226,876 V392E probably damaging Het
Fanca A G 8: 123,271,260 V1229A probably benign Het
Fdps G T 3: 89,099,386 Q66K probably benign Het
Fer1l6 T A 15: 58,627,589 D1269E probably benign Het
Foxred1 G A 9: 35,205,636 R353W probably damaging Het
Gabrg2 C T 11: 41,967,624 V226I possibly damaging Het
Gcnt2 C A 13: 40,860,867 C171* probably null Het
Glyat C A 19: 12,639,808 A8E probably damaging Het
Golgb1 C A 16: 36,875,396 R86S unknown Het
Hc T A 2: 35,050,419 T136S probably damaging Het
Hdac1 G T 4: 129,517,466 S421* probably null Het
Hmcn2 G T 2: 31,356,286 A756S possibly damaging Het
Igkv8-26 A G 6: 70,193,587 N54S probably benign Het
Impad1 G A 4: 4,778,207 T177I probably damaging Het
Itgae T A 11: 73,121,960 V706E possibly damaging Het
Itgax G A 7: 128,148,090 V992M probably damaging Het
Klk10 A G 7: 43,784,427 D221G probably benign Het
Kpna2 T C 11: 106,998,757 N8S probably null Het
L3mbtl1 A C 2: 162,964,514 T442P possibly damaging Het
Lrp1b C T 2: 40,661,549 C4181Y Het
Mcat T C 15: 83,547,671 Y332C probably damaging Het
Mecom T C 3: 29,956,385 D648G probably damaging Het
Mesp2 A T 7: 79,810,969 D14V probably damaging Het
Mlh3 A T 12: 85,268,199 Y404* probably null Het
Mterf3 A T 13: 66,917,148 F230I probably damaging Het
Nrxn3 T C 12: 89,512,062 V602A probably benign Het
Olfr1247 T A 2: 89,609,227 I292F possibly damaging Het
Plekhg6 A G 6: 125,374,660 F209L probably damaging Het
Pmp22 C A 11: 63,158,348 A139D probably damaging Het
Polr2e T C 10: 80,038,570 D34G possibly damaging Het
Ppard T A 17: 28,297,117 L105H probably damaging Het
Ptpn14 T A 1: 189,850,745 D596E probably benign Het
Ptprz1 C T 6: 23,002,519 A1536V not run Het
Rabgap1 TGGGG TGGG 2: 37,502,896 probably null Het
Retreg1 T A 15: 25,971,641 D222E probably benign Het
Rmnd1 T C 10: 4,413,404 K282R probably benign Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Sall3 C T 18: 80,972,052 R887H possibly damaging Het
Samd3 A G 10: 26,263,813 D281G probably benign Het
Scube1 T A 15: 83,613,452 D766V probably damaging Het
Sec24b TGC TGCAGC 3: 130,040,811 probably benign Het
Slc2a2 A G 3: 28,698,017 M1V probably null Het
Slc39a2 A T 14: 51,895,031 T144S probably benign Het
Slc5a9 T C 4: 111,877,740 H619R probably benign Het
Slco4a1 T C 2: 180,471,255 F427L probably benign Het
Snapc3 C A 4: 83,417,836 Y28* probably null Het
St3gal6 C T 16: 58,473,437 R243H probably benign Het
Stat2 T A 10: 128,277,197 N119K possibly damaging Het
Syne2 G C 12: 75,966,371 V2779L probably benign Het
Tacc1 T A 8: 25,201,285 M1L probably damaging Het
Tbc1d32 A T 10: 56,151,833 F724L possibly damaging Het
Ttc23l A G 15: 10,533,680 I259T possibly damaging Het
Ucn2 T C 9: 108,986,224 I18T probably benign Het
Wdr35 G C 12: 9,024,886 A1000P probably benign Het
Wnk1 C A 6: 119,929,828 C244F possibly damaging Het
Zeb2 T G 2: 44,994,613 D1022A probably damaging Het
Zfp26 A T 9: 20,437,833 H478Q probably damaging Het
Zfp410 A G 12: 84,331,856 K265R probably benign Het
Zfp575 T C 7: 24,586,668 D21G probably benign Het
Other mutations in Klkb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00979:Klkb1 APN 8 45294068 splice site probably benign
IGL01756:Klkb1 APN 8 45272324 missense probably damaging 0.99
IGL01783:Klkb1 APN 8 45276391 missense probably damaging 1.00
IGL01809:Klkb1 APN 8 45276053 missense probably benign 0.00
IGL02128:Klkb1 APN 8 45287031 missense probably damaging 1.00
IGL02512:Klkb1 APN 8 45276240 splice site probably benign
E0374:Klkb1 UTSW 8 45289091 missense possibly damaging 0.58
R0048:Klkb1 UTSW 8 45289196 splice site probably benign
R0149:Klkb1 UTSW 8 45276063 missense probably damaging 1.00
R0278:Klkb1 UTSW 8 45272409 missense probably benign 0.27
R0551:Klkb1 UTSW 8 45277966 critical splice donor site probably null
R1103:Klkb1 UTSW 8 45276146 missense probably damaging 1.00
R1420:Klkb1 UTSW 8 45276146 missense probably damaging 1.00
R1930:Klkb1 UTSW 8 45275477 missense probably benign 0.13
R1931:Klkb1 UTSW 8 45275477 missense probably benign 0.13
R2125:Klkb1 UTSW 8 45275504 missense possibly damaging 0.68
R2418:Klkb1 UTSW 8 45289112 missense possibly damaging 0.86
R2419:Klkb1 UTSW 8 45289112 missense possibly damaging 0.86
R3938:Klkb1 UTSW 8 45282801 missense probably damaging 0.99
R4445:Klkb1 UTSW 8 45277055 missense probably benign 0.11
R4461:Klkb1 UTSW 8 45273575 missense probably damaging 1.00
R4969:Klkb1 UTSW 8 45282777 missense probably benign 0.43
R4974:Klkb1 UTSW 8 45286958 missense probably damaging 1.00
R5113:Klkb1 UTSW 8 45270697 missense probably benign 0.00
R5117:Klkb1 UTSW 8 45289112 missense possibly damaging 0.86
R5339:Klkb1 UTSW 8 45270711 missense possibly damaging 0.93
R5891:Klkb1 UTSW 8 45270666 missense probably benign 0.13
R6230:Klkb1 UTSW 8 45283215 missense probably benign 0.03
R6554:Klkb1 UTSW 8 45273554 missense probably damaging 1.00
R6564:Klkb1 UTSW 8 45273634 missense probably damaging 0.98
R7130:Klkb1 UTSW 8 45275538 missense probably benign 0.00
R7497:Klkb1 UTSW 8 45294790 utr 3 prime probably benign
R7867:Klkb1 UTSW 8 45286965 missense probably damaging 1.00
R7950:Klkb1 UTSW 8 45286965 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCTCGCAAGGAACGGAAAG -3'
(R):5'- AGGCTTTCCTCCTCTTATTGAAATG -3'

Sequencing Primer
(F):5'- GGGCTAGAAGGGGGCGC -3'
(R):5'- ATAGTCAAGTGGAAGCTATACCC -3'
Posted On2019-10-24