Mutagenetix > Incidental Mutations

Incidental Mutation 'R7599:Tbc1d32'

587913

Institutional Source

Beutler Lab

Gene Symbol

Tbc1d32

Ensembl Gene

ENSMUSG00000038122

Gene Name

TBC1 domain family, member 32

Synonyms

D630037F22Rik, C6orf170, Bromi, b2b2284Clo

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.908) question?

Stock #

R7599 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

56014293-56228689 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 56151833 bp

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 724 (F724L)

Ref Sequence

ENSEMBL: ENSMUSP00000097328 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000099739]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000099739
AA Change: F724L

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000097328
Gene: ENSMUSG00000038122
AA Change: F724L

Domain	Start	End	E-Value	Type
Pfam:BROMI	12	1293	N/A	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a TBC-domain containing protein. Studies of a similar protein in mouse and zebrafish suggest that the encoded protein is involved in sonic hedgehog signaling, and that it interacts with and stabilizes cell cycle-related kinase. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a gene trap allele or ENU induced mutation exhibit exencephaly and poor eye development. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2210016F16Rik	T	A	13: 58,381,835	H321L	probably damaging	Het
Adamts3	T	C	5: 89,861,397	S136G	probably benign	Het
Apba3	T	A	10: 81,272,346	N445K	probably damaging	Het
Aqp6	A	G	15: 99,603,771	K237E	possibly damaging	Het
Arhgap23	A	G	11: 97,500,343	T1229A	probably benign	Het
Bpifb1	T	C	2: 154,214,151	I379T	probably damaging	Het
Ccdc169	A	G	3: 55,140,109	D7G	probably damaging	Het
Cyp2f2	T	A	7: 27,131,359		probably null	Het
Daam2	T	A	17: 49,480,727	K453*	probably null	Het
Dennd4c	T	C	4: 86,811,612	L817P	probably damaging	Het
Efcab6	T	A	15: 83,870,988	R1376W	probably damaging	Het
Esrra	G	T	19: 6,913,846	A182E	possibly damaging	Het
Fam234b	T	A	6: 135,226,876	V392E	probably damaging	Het
Fanca	A	G	8: 123,271,260	V1229A	probably benign	Het
Fdps	G	T	3: 89,099,386	Q66K	probably benign	Het
Fer1l6	T	A	15: 58,627,589	D1269E	probably benign	Het
Foxred1	G	A	9: 35,205,636	R353W	probably damaging	Het
Gabrg2	C	T	11: 41,967,624	V226I	possibly damaging	Het
Gcnt2	C	A	13: 40,860,867	C171*	probably null	Het
Glyat	C	A	19: 12,639,808	A8E	probably damaging	Het
Golgb1	C	A	16: 36,875,396	R86S	unknown	Het
Hc	T	A	2: 35,050,419	T136S	probably damaging	Het
Hdac1	G	T	4: 129,517,466	S421*	probably null	Het
Hmcn2	G	T	2: 31,356,286	A756S	possibly damaging	Het
Igkv8-26	A	G	6: 70,193,587	N54S	probably benign	Het
Impad1	G	A	4: 4,778,207	T177I	probably damaging	Het
Itgae	T	A	11: 73,121,960	V706E	possibly damaging	Het
Itgax	G	A	7: 128,148,090	V992M	probably damaging	Het
Klk10	A	G	7: 43,784,427	D221G	probably benign	Het
Klkb1	T	C	8: 45,278,113	I205V	probably benign	Het
Kpna2	T	C	11: 106,998,757	N8S	probably null	Het
L3mbtl1	A	C	2: 162,964,514	T442P	possibly damaging	Het
Lrp1b	C	T	2: 40,661,549	C4181Y		Het
Mcat	T	C	15: 83,547,671	Y332C	probably damaging	Het
Mecom	T	C	3: 29,956,385	D648G	probably damaging	Het
Mesp2	A	T	7: 79,810,969	D14V	probably damaging	Het
Mlh3	A	T	12: 85,268,199	Y404*	probably null	Het
Mterf3	A	T	13: 66,917,148	F230I	probably damaging	Het
Nrxn3	T	C	12: 89,512,062	V602A	probably benign	Het
Olfr1247	T	A	2: 89,609,227	I292F	possibly damaging	Het
Plekhg6	A	G	6: 125,374,660	F209L	probably damaging	Het
Pmp22	C	A	11: 63,158,348	A139D	probably damaging	Het
Polr2e	T	C	10: 80,038,570	D34G	possibly damaging	Het
Ppard	T	A	17: 28,297,117	L105H	probably damaging	Het
Ptpn14	T	A	1: 189,850,745	D596E	probably benign	Het
Ptprz1	C	T	6: 23,002,519	A1536V	not run	Het
Rabgap1	TGGGG	TGGG	2: 37,502,896		probably null	Het
Retreg1	T	A	15: 25,971,641	D222E	probably benign	Het
Rmnd1	T	C	10: 4,413,404	K282R	probably benign	Het
Rsf1	ATGGCG	ATGGCGACGGTGGCG	7: 97,579,904		probably benign	Het
Sall3	C	T	18: 80,972,052	R887H	possibly damaging	Het
Samd3	A	G	10: 26,263,813	D281G	probably benign	Het
Scube1	T	A	15: 83,613,452	D766V	probably damaging	Het
Sec24b	TGC	TGCAGC	3: 130,040,811		probably benign	Het
Slc2a2	A	G	3: 28,698,017	M1V	probably null	Het
Slc39a2	A	T	14: 51,895,031	T144S	probably benign	Het
Slc5a9	T	C	4: 111,877,740	H619R	probably benign	Het
Slco4a1	T	C	2: 180,471,255	F427L	probably benign	Het
Snapc3	C	A	4: 83,417,836	Y28*	probably null	Het
St3gal6	C	T	16: 58,473,437	R243H	probably benign	Het
Stat2	T	A	10: 128,277,197	N119K	possibly damaging	Het
Syne2	G	C	12: 75,966,371	V2779L	probably benign	Het
Tacc1	T	A	8: 25,201,285	M1L	probably damaging	Het
Ttc23l	A	G	15: 10,533,680	I259T	possibly damaging	Het
Ucn2	T	C	9: 108,986,224	I18T	probably benign	Het
Wdr35	G	C	12: 9,024,886	A1000P	probably benign	Het
Wnk1	C	A	6: 119,929,828	C244F	possibly damaging	Het
Zeb2	T	G	2: 44,994,613	D1022A	probably damaging	Het
Zfp26	A	T	9: 20,437,833	H478Q	probably damaging	Het
Zfp410	A	G	12: 84,331,856	K265R	probably benign	Het
Zfp575	T	C	7: 24,586,668	D21G	probably benign	Het

Other mutations in Tbc1d32

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00490:Tbc1d32	APN	10	56155765	missense	probably damaging	1.00
IGL00535:Tbc1d32	APN	10	56215125	splice site	probably benign
IGL00835:Tbc1d32	APN	10	56089846	splice site	probably benign
IGL01013:Tbc1d32	APN	10	56201959	splice site	probably null
IGL01306:Tbc1d32	APN	10	56180524	missense	probably benign	0.14
IGL01452:Tbc1d32	APN	10	56215080	missense	possibly damaging	0.71
IGL01668:Tbc1d32	APN	10	56123577	missense	probably benign	0.37
IGL02008:Tbc1d32	APN	10	56151775	missense	possibly damaging	0.71
IGL02076:Tbc1d32	APN	10	56088403	missense	possibly damaging	0.93
IGL02348:Tbc1d32	APN	10	56224619	missense	probably benign	0.06
IGL02476:Tbc1d32	APN	10	56198542	missense	possibly damaging	0.71
IGL02750:Tbc1d32	APN	10	56198491	missense	possibly damaging	0.95
IGL02893:Tbc1d32	APN	10	56017703	missense	probably damaging	0.98
ANU23:Tbc1d32	UTSW	10	56180524	missense	probably benign	0.14
P0035:Tbc1d32	UTSW	10	56198439	missense	probably damaging	1.00
R0118:Tbc1d32	UTSW	10	56017605	missense	probably benign	0.02
R0446:Tbc1d32	UTSW	10	56192898	missense	possibly damaging	0.93
R0567:Tbc1d32	UTSW	10	56173963	missense	possibly damaging	0.71
R0615:Tbc1d32	UTSW	10	56224640	missense	probably benign	0.33
R0679:Tbc1d32	UTSW	10	56180576	missense	probably damaging	0.99
R0943:Tbc1d32	UTSW	10	56161147	missense	probably benign
R1432:Tbc1d32	UTSW	10	56017662	missense	probably damaging	0.99
R1454:Tbc1d32	UTSW	10	56177479	splice site	probably benign
R1708:Tbc1d32	UTSW	10	56151769	missense	possibly damaging	0.84
R1834:Tbc1d32	UTSW	10	56017604	missense	probably benign	0.00
R1860:Tbc1d32	UTSW	10	56123537	nonsense	probably null
R2208:Tbc1d32	UTSW	10	56150792	critical splice donor site	probably null
R3012:Tbc1d32	UTSW	10	56173915	missense	probably benign	0.08
R3736:Tbc1d32	UTSW	10	56129093	missense	probably damaging	0.99
R4184:Tbc1d32	UTSW	10	56224580	missense	probably benign	0.15
R4259:Tbc1d32	UTSW	10	56049771	missense	probably damaging	0.97
R4617:Tbc1d32	UTSW	10	56170904	missense	possibly damaging	0.92
R4700:Tbc1d32	UTSW	10	56224649	missense	probably damaging	0.98
R4794:Tbc1d32	UTSW	10	56196836	missense	possibly damaging	0.92
R4879:Tbc1d32	UTSW	10	56049029	splice site	probably null
R5031:Tbc1d32	UTSW	10	56123531	missense	probably damaging	0.98
R5036:Tbc1d32	UTSW	10	56195404	nonsense	probably null
R5276:Tbc1d32	UTSW	10	56151818	missense	probably damaging	0.99
R5358:Tbc1d32	UTSW	10	56170937	missense	possibly damaging	0.93
R5429:Tbc1d32	UTSW	10	56027993	missense	probably damaging	0.99
R5435:Tbc1d32	UTSW	10	56040150	missense	probably damaging	0.98
R5451:Tbc1d32	UTSW	10	56195475	missense	possibly damaging	0.95
R5607:Tbc1d32	UTSW	10	56129150	missense	possibly damaging	0.92
R5642:Tbc1d32	UTSW	10	56150877	missense	possibly damaging	0.82
R5732:Tbc1d32	UTSW	10	56088393	missense	probably damaging	0.99
R5795:Tbc1d32	UTSW	10	56215062	missense	possibly damaging	0.71
R5988:Tbc1d32	UTSW	10	56088337	missense	probably damaging	0.98
R6054:Tbc1d32	UTSW	10	56162208	missense	possibly damaging	0.95
R6103:Tbc1d32	UTSW	10	56150883	missense	probably damaging	0.99
R6277:Tbc1d32	UTSW	10	56195429	missense	probably benign
R6422:Tbc1d32	UTSW	10	56028061	nonsense	probably null
R6508:Tbc1d32	UTSW	10	56224690	missense	probably damaging	0.98
R6859:Tbc1d32	UTSW	10	56180530	missense	probably damaging	0.98
R6887:Tbc1d32	UTSW	10	56151811	nonsense	probably null
R7012:Tbc1d32	UTSW	10	56224724	missense	probably damaging	0.99
R7253:Tbc1d32	UTSW	10	56198441	missense	probably benign
R7288:Tbc1d32	UTSW	10	56051387	critical splice donor site	probably null
R8338:Tbc1d32	UTSW	10	56028077	missense	possibly damaging	0.85
R8814:Tbc1d32	UTSW	10	56196592	missense	possibly damaging	0.93
Z1188:Tbc1d32	UTSW	10	56170881	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TCAACATAGTCACAAACTGGGAAG -3'
(R):5'- GCTAGGCTTAAACTCAAACCAG -3'

Sequencing Primer
(F):5'- TCACAAACTGGGAAGTAGAATTTTAG -3'
(R):5'- GGTACTAATTCACTGTAAGGGTTTC -3'

Posted On

2019-10-24