Incidental Mutation 'R7599:Apba3'
ID 587915
Institutional Source Beutler Lab
Gene Symbol Apba3
Ensembl Gene ENSMUSG00000004931
Gene Name amyloid beta precursor protein binding family A member 3
Synonyms Mint 3, Mint-3, X11gamma, lin-10, neuron-specific X11L2 protein, neuronal munc18-1-interacting protein 3
MMRRC Submission 045673-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.453) question?
Stock # R7599 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 81102799-81109081 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 81108180 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 445 (N445K)
Ref Sequence ENSEMBL: ENSMUSP00000050995 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045744] [ENSMUST00000057798] [ENSMUST00000218742] [ENSMUST00000219304] [ENSMUST00000219460] [ENSMUST00000219479] [ENSMUST00000220297]
AlphaFold O88888
Predicted Effect probably benign
Transcript: ENSMUST00000045744
SMART Domains Protein: ENSMUSP00000036438
Gene: ENSMUSG00000034917

DomainStartEndE-ValueType
PDZ 20 93 2.81e-18 SMART
low complexity region 119 162 N/A INTRINSIC
PDZ 196 264 2.71e-11 SMART
low complexity region 297 305 N/A INTRINSIC
PDZ 378 451 4.97e-19 SMART
SH3 466 539 9.96e-2 SMART
low complexity region 548 559 N/A INTRINSIC
GuKc 570 756 6.9e-46 SMART
Blast:GuKc 767 898 9e-27 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000057798
AA Change: N445K

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000050995
Gene: ENSMUSG00000004931
AA Change: N445K

DomainStartEndE-ValueType
low complexity region 5 14 N/A INTRINSIC
low complexity region 98 120 N/A INTRINSIC
low complexity region 155 171 N/A INTRINSIC
PTB 213 359 3.03e-40 SMART
PDZ 400 478 3.74e-14 SMART
PDZ 492 557 9.58e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000218297
Predicted Effect probably benign
Transcript: ENSMUST00000218742
Predicted Effect probably benign
Transcript: ENSMUST00000219304
Predicted Effect probably damaging
Transcript: ENSMUST00000219460
AA Change: N221K

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect probably benign
Transcript: ENSMUST00000219479
Predicted Effect probably damaging
Transcript: ENSMUST00000220297
AA Change: N445K

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the X11 protein family. It is an adapter protein that interacts with the Alzheimer's disease amyloid precursor protein. This gene product is believed to be involved in signal transduction processes. This gene is a candidate gene for Alzheimer's disease. [provided by RefSeq, Jul 2008]
PHENOTYPE: Deletion in mutants causes abnormalities in colon morphology and physiology, increased circulating blood urea nitrogen, and decreased serum chloride, sodium and potassium levels. Surviving homozygotes display diarrhea, postnatal viability and decreased life span. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts3 T C 5: 90,009,256 (GRCm39) S136G probably benign Het
Aqp6 A G 15: 99,501,652 (GRCm39) K237E possibly damaging Het
Arhgap23 A G 11: 97,391,169 (GRCm39) T1229A probably benign Het
Bpifb1 T C 2: 154,056,071 (GRCm39) I379T probably damaging Het
Bpnt2 G A 4: 4,778,207 (GRCm39) T177I probably damaging Het
Ccdc169 A G 3: 55,047,530 (GRCm39) D7G probably damaging Het
Cyp2f2 T A 7: 26,830,784 (GRCm39) probably null Het
Daam2 T A 17: 49,787,755 (GRCm39) K453* probably null Het
Dennd4c T C 4: 86,729,849 (GRCm39) L817P probably damaging Het
Efcab6 T A 15: 83,755,189 (GRCm39) R1376W probably damaging Het
Esrra G T 19: 6,891,214 (GRCm39) A182E possibly damaging Het
Fam234b T A 6: 135,203,874 (GRCm39) V392E probably damaging Het
Fanca A G 8: 123,997,999 (GRCm39) V1229A probably benign Het
Fdps G T 3: 89,006,693 (GRCm39) Q66K probably benign Het
Fer1l6 T A 15: 58,499,438 (GRCm39) D1269E probably benign Het
Foxred1 G A 9: 35,116,932 (GRCm39) R353W probably damaging Het
Gabrg2 C T 11: 41,858,451 (GRCm39) V226I possibly damaging Het
Gcnt2 C A 13: 41,014,343 (GRCm39) C171* probably null Het
Glyat C A 19: 12,617,172 (GRCm39) A8E probably damaging Het
Golgb1 C A 16: 36,695,758 (GRCm39) R86S unknown Het
Hc T A 2: 34,940,431 (GRCm39) T136S probably damaging Het
Hdac1 G T 4: 129,411,259 (GRCm39) S421* probably null Het
Hmcn2 G T 2: 31,246,298 (GRCm39) A756S possibly damaging Het
Igkv8-26 A G 6: 70,170,571 (GRCm39) N54S probably benign Het
Itgae T A 11: 73,012,786 (GRCm39) V706E possibly damaging Het
Itgax G A 7: 127,747,262 (GRCm39) V992M probably damaging Het
Klk10 A G 7: 43,433,851 (GRCm39) D221G probably benign Het
Klkb1 T C 8: 45,731,150 (GRCm39) I205V probably benign Het
Kpna2 T C 11: 106,889,583 (GRCm39) N8S probably null Het
L3mbtl1 A C 2: 162,806,434 (GRCm39) T442P possibly damaging Het
Lrp1b C T 2: 40,551,561 (GRCm39) C4181Y Het
Mcat T C 15: 83,431,872 (GRCm39) Y332C probably damaging Het
Mecom T C 3: 30,010,534 (GRCm39) D648G probably damaging Het
Mesp2 A T 7: 79,460,717 (GRCm39) D14V probably damaging Het
Mlh3 A T 12: 85,314,973 (GRCm39) Y404* probably null Het
Mterf3 A T 13: 67,065,212 (GRCm39) F230I probably damaging Het
Nrxn3 T C 12: 89,478,832 (GRCm39) V602A probably benign Het
Or4a74 T A 2: 89,439,571 (GRCm39) I292F possibly damaging Het
Plekhg6 A G 6: 125,351,623 (GRCm39) F209L probably damaging Het
Pmp22 C A 11: 63,049,174 (GRCm39) A139D probably damaging Het
Polr2e T C 10: 79,874,404 (GRCm39) D34G possibly damaging Het
Ppard T A 17: 28,516,091 (GRCm39) L105H probably damaging Het
Ptpn14 T A 1: 189,582,942 (GRCm39) D596E probably benign Het
Ptprz1 C T 6: 23,002,518 (GRCm39) A1536V not run Het
Qng1 T A 13: 58,529,649 (GRCm39) H321L probably damaging Het
Rabgap1 TGGGG TGGG 2: 37,392,908 (GRCm39) probably null Het
Retreg1 T A 15: 25,971,727 (GRCm39) D222E probably benign Het
Rmnd1 T C 10: 4,363,404 (GRCm39) K282R probably benign Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,229,111 (GRCm39) probably benign Het
Sall3 C T 18: 81,015,267 (GRCm39) R887H possibly damaging Het
Samd3 A G 10: 26,139,711 (GRCm39) D281G probably benign Het
Scube1 T A 15: 83,497,653 (GRCm39) D766V probably damaging Het
Sec24b TGC TGCAGC 3: 129,834,460 (GRCm39) probably benign Het
Slc2a2 A G 3: 28,752,166 (GRCm39) M1V probably null Het
Slc39a2 A T 14: 52,132,488 (GRCm39) T144S probably benign Het
Slc5a9 T C 4: 111,734,937 (GRCm39) H619R probably benign Het
Slco4a1 T C 2: 180,113,048 (GRCm39) F427L probably benign Het
Snapc3 C A 4: 83,336,073 (GRCm39) Y28* probably null Het
St3gal6 C T 16: 58,293,800 (GRCm39) R243H probably benign Het
Stat2 T A 10: 128,113,066 (GRCm39) N119K possibly damaging Het
Syne2 G C 12: 76,013,145 (GRCm39) V2779L probably benign Het
Tacc1 T A 8: 25,691,301 (GRCm39) M1L probably damaging Het
Tbc1d32 A T 10: 56,027,929 (GRCm39) F724L possibly damaging Het
Ttc23l A G 15: 10,533,766 (GRCm39) I259T possibly damaging Het
Ucn2 T C 9: 108,815,292 (GRCm39) I18T probably benign Het
Wdr35 G C 12: 9,074,886 (GRCm39) A1000P probably benign Het
Wnk1 C A 6: 119,906,789 (GRCm39) C244F possibly damaging Het
Zeb2 T G 2: 44,884,625 (GRCm39) D1022A probably damaging Het
Zfp26 A T 9: 20,349,129 (GRCm39) H478Q probably damaging Het
Zfp410 A G 12: 84,378,630 (GRCm39) K265R probably benign Het
Zfp575 T C 7: 24,286,093 (GRCm39) D21G probably benign Het
Other mutations in Apba3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00329:Apba3 APN 10 81,108,901 (GRCm39) missense probably damaging 1.00
IGL00332:Apba3 APN 10 81,108,901 (GRCm39) missense probably damaging 1.00
IGL01577:Apba3 APN 10 81,108,053 (GRCm39) missense probably damaging 1.00
IGL01924:Apba3 APN 10 81,108,907 (GRCm39) missense probably benign 0.01
IGL02655:Apba3 APN 10 81,108,788 (GRCm39) missense probably benign 0.20
IGL03163:Apba3 APN 10 81,105,057 (GRCm39) splice site probably null
R1381:Apba3 UTSW 10 81,107,590 (GRCm39) missense possibly damaging 0.76
R2073:Apba3 UTSW 10 81,105,128 (GRCm39) missense probably benign
R2114:Apba3 UTSW 10 81,108,946 (GRCm39) missense probably damaging 1.00
R2196:Apba3 UTSW 10 81,107,542 (GRCm39) missense probably damaging 1.00
R3773:Apba3 UTSW 10 81,108,443 (GRCm39) splice site probably null
R4895:Apba3 UTSW 10 81,107,117 (GRCm39) critical splice donor site probably null
R4936:Apba3 UTSW 10 81,105,204 (GRCm39) splice site probably null
R6576:Apba3 UTSW 10 81,108,925 (GRCm39) missense probably benign 0.04
R7141:Apba3 UTSW 10 81,108,889 (GRCm39) missense probably damaging 1.00
R7305:Apba3 UTSW 10 81,107,067 (GRCm39) missense probably damaging 1.00
R7498:Apba3 UTSW 10 81,104,735 (GRCm39) missense possibly damaging 0.55
R8399:Apba3 UTSW 10 81,104,832 (GRCm39) missense probably benign 0.21
R8791:Apba3 UTSW 10 81,105,104 (GRCm39) missense probably benign 0.00
R8974:Apba3 UTSW 10 81,109,032 (GRCm39) missense
R9159:Apba3 UTSW 10 81,106,867 (GRCm39) missense
X0020:Apba3 UTSW 10 81,106,883 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGTGCAGCTTCTCCCACAC -3'
(R):5'- GGCAACATGGGGATGCAATC -3'

Sequencing Primer
(F):5'- ACACTGCCCCTGAATGTG -3'
(R):5'- GATGCAATCAGTGGTACCATACAGTC -3'
Posted On 2019-10-24