Incidental Mutation 'R7599:Apba3'
ID587915
Institutional Source Beutler Lab
Gene Symbol Apba3
Ensembl Gene ENSMUSG00000004931
Gene Nameamyloid beta (A4) precursor protein-binding, family A, member 3
SynonymsX11gamma, neuronal munc18-1-interacting protein 3, Mint 3, neuron-specific X11L2 protein, Mint-3, lin-10
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.410) question?
Stock #R7599 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location81266960-81273246 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 81272346 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 445 (N445K)
Ref Sequence ENSEMBL: ENSMUSP00000050995 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045744] [ENSMUST00000057798] [ENSMUST00000218742] [ENSMUST00000219304] [ENSMUST00000219460] [ENSMUST00000219479] [ENSMUST00000220297]
Predicted Effect probably benign
Transcript: ENSMUST00000045744
SMART Domains Protein: ENSMUSP00000036438
Gene: ENSMUSG00000034917

DomainStartEndE-ValueType
PDZ 20 93 2.81e-18 SMART
low complexity region 119 162 N/A INTRINSIC
PDZ 196 264 2.71e-11 SMART
low complexity region 297 305 N/A INTRINSIC
PDZ 378 451 4.97e-19 SMART
SH3 466 539 9.96e-2 SMART
low complexity region 548 559 N/A INTRINSIC
GuKc 570 756 6.9e-46 SMART
Blast:GuKc 767 898 9e-27 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000057798
AA Change: N445K

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000050995
Gene: ENSMUSG00000004931
AA Change: N445K

DomainStartEndE-ValueType
low complexity region 5 14 N/A INTRINSIC
low complexity region 98 120 N/A INTRINSIC
low complexity region 155 171 N/A INTRINSIC
PTB 213 359 3.03e-40 SMART
PDZ 400 478 3.74e-14 SMART
PDZ 492 557 9.58e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000218297
Predicted Effect probably benign
Transcript: ENSMUST00000218742
Predicted Effect probably benign
Transcript: ENSMUST00000219304
Predicted Effect probably damaging
Transcript: ENSMUST00000219460
AA Change: N221K

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect probably benign
Transcript: ENSMUST00000219479
Predicted Effect probably damaging
Transcript: ENSMUST00000220297
AA Change: N445K

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the X11 protein family. It is an adapter protein that interacts with the Alzheimer's disease amyloid precursor protein. This gene product is believed to be involved in signal transduction processes. This gene is a candidate gene for Alzheimer's disease. [provided by RefSeq, Jul 2008]
PHENOTYPE: Deletion in mutants causes abnormalities in colon morphology and physiology, increased circulating blood urea nitrogen, and decreased serum chloride, sodium and potassium levels. Surviving homozygotes display diarrhea, postnatal viability and decreased life span. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210016F16Rik T A 13: 58,381,835 H321L probably damaging Het
Adamts3 T C 5: 89,861,397 S136G probably benign Het
Aqp6 A G 15: 99,603,771 K237E possibly damaging Het
Arhgap23 A G 11: 97,500,343 T1229A probably benign Het
Bpifb1 T C 2: 154,214,151 I379T probably damaging Het
Ccdc169 A G 3: 55,140,109 D7G probably damaging Het
Cyp2f2 T A 7: 27,131,359 probably null Het
Daam2 T A 17: 49,480,727 K453* probably null Het
Dennd4c T C 4: 86,811,612 L817P probably damaging Het
Efcab6 T A 15: 83,870,988 R1376W probably damaging Het
Esrra G T 19: 6,913,846 A182E possibly damaging Het
Fam234b T A 6: 135,226,876 V392E probably damaging Het
Fanca A G 8: 123,271,260 V1229A probably benign Het
Fdps G T 3: 89,099,386 Q66K probably benign Het
Fer1l6 T A 15: 58,627,589 D1269E probably benign Het
Foxred1 G A 9: 35,205,636 R353W probably damaging Het
Gabrg2 C T 11: 41,967,624 V226I possibly damaging Het
Gcnt2 C A 13: 40,860,867 C171* probably null Het
Glyat C A 19: 12,639,808 A8E probably damaging Het
Golgb1 C A 16: 36,875,396 R86S unknown Het
Hc T A 2: 35,050,419 T136S probably damaging Het
Hdac1 G T 4: 129,517,466 S421* probably null Het
Hmcn2 G T 2: 31,356,286 A756S possibly damaging Het
Igkv8-26 A G 6: 70,193,587 N54S probably benign Het
Impad1 G A 4: 4,778,207 T177I probably damaging Het
Itgae T A 11: 73,121,960 V706E possibly damaging Het
Itgax G A 7: 128,148,090 V992M probably damaging Het
Klk10 A G 7: 43,784,427 D221G probably benign Het
Klkb1 T C 8: 45,278,113 I205V probably benign Het
Kpna2 T C 11: 106,998,757 N8S probably null Het
L3mbtl1 A C 2: 162,964,514 T442P possibly damaging Het
Lrp1b C T 2: 40,661,549 C4181Y Het
Mcat T C 15: 83,547,671 Y332C probably damaging Het
Mecom T C 3: 29,956,385 D648G probably damaging Het
Mesp2 A T 7: 79,810,969 D14V probably damaging Het
Mlh3 A T 12: 85,268,199 Y404* probably null Het
Mterf3 A T 13: 66,917,148 F230I probably damaging Het
Nrxn3 T C 12: 89,512,062 V602A probably benign Het
Olfr1247 T A 2: 89,609,227 I292F possibly damaging Het
Plekhg6 A G 6: 125,374,660 F209L probably damaging Het
Pmp22 C A 11: 63,158,348 A139D probably damaging Het
Polr2e T C 10: 80,038,570 D34G possibly damaging Het
Ppard T A 17: 28,297,117 L105H probably damaging Het
Ptpn14 T A 1: 189,850,745 D596E probably benign Het
Ptprz1 C T 6: 23,002,519 A1536V not run Het
Rabgap1 TGGGG TGGG 2: 37,502,896 probably null Het
Retreg1 T A 15: 25,971,641 D222E probably benign Het
Rmnd1 T C 10: 4,413,404 K282R probably benign Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Sall3 C T 18: 80,972,052 R887H possibly damaging Het
Samd3 A G 10: 26,263,813 D281G probably benign Het
Scube1 T A 15: 83,613,452 D766V probably damaging Het
Sec24b TGC TGCAGC 3: 130,040,811 probably benign Het
Slc2a2 A G 3: 28,698,017 M1V probably null Het
Slc39a2 A T 14: 51,895,031 T144S probably benign Het
Slc5a9 T C 4: 111,877,740 H619R probably benign Het
Slco4a1 T C 2: 180,471,255 F427L probably benign Het
Snapc3 C A 4: 83,417,836 Y28* probably null Het
St3gal6 C T 16: 58,473,437 R243H probably benign Het
Stat2 T A 10: 128,277,197 N119K possibly damaging Het
Syne2 G C 12: 75,966,371 V2779L probably benign Het
Tacc1 T A 8: 25,201,285 M1L probably damaging Het
Tbc1d32 A T 10: 56,151,833 F724L possibly damaging Het
Ttc23l A G 15: 10,533,680 I259T possibly damaging Het
Ucn2 T C 9: 108,986,224 I18T probably benign Het
Wdr35 G C 12: 9,024,886 A1000P probably benign Het
Wnk1 C A 6: 119,929,828 C244F possibly damaging Het
Zeb2 T G 2: 44,994,613 D1022A probably damaging Het
Zfp26 A T 9: 20,437,833 H478Q probably damaging Het
Zfp410 A G 12: 84,331,856 K265R probably benign Het
Zfp575 T C 7: 24,586,668 D21G probably benign Het
Other mutations in Apba3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00329:Apba3 APN 10 81273067 missense probably damaging 1.00
IGL00332:Apba3 APN 10 81273067 missense probably damaging 1.00
IGL01577:Apba3 APN 10 81272219 missense probably damaging 1.00
IGL01924:Apba3 APN 10 81273073 missense probably benign 0.01
IGL02655:Apba3 APN 10 81272954 missense probably benign 0.20
IGL03163:Apba3 APN 10 81269223 unclassified probably null
R1381:Apba3 UTSW 10 81271756 missense possibly damaging 0.76
R2073:Apba3 UTSW 10 81269294 missense probably benign
R2114:Apba3 UTSW 10 81273112 missense probably damaging 1.00
R2196:Apba3 UTSW 10 81271708 missense probably damaging 1.00
R3773:Apba3 UTSW 10 81272609 unclassified probably null
R4895:Apba3 UTSW 10 81271283 critical splice donor site probably null
R4936:Apba3 UTSW 10 81269370 unclassified probably null
R6576:Apba3 UTSW 10 81273091 missense probably benign 0.04
R7141:Apba3 UTSW 10 81273055 missense probably damaging 1.00
R7305:Apba3 UTSW 10 81271233 missense probably damaging 1.00
R7498:Apba3 UTSW 10 81268901 missense possibly damaging 0.55
X0020:Apba3 UTSW 10 81271049 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGTGCAGCTTCTCCCACAC -3'
(R):5'- GGCAACATGGGGATGCAATC -3'

Sequencing Primer
(F):5'- ACACTGCCCCTGAATGTG -3'
(R):5'- GATGCAATCAGTGGTACCATACAGTC -3'
Posted On2019-10-24