Incidental Mutation 'R7599:Gabrg2'
ID 587917
Institutional Source Beutler Lab
Gene Symbol Gabrg2
Ensembl Gene ENSMUSG00000020436
Gene Name gamma-aminobutyric acid (GABA) A receptor, subunit gamma 2
Synonyms gamma2, Gabrg-2, GABAA-R
MMRRC Submission
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.303) question?
Stock # R7599 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 41910203-42000857 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 41967624 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 226 (V226I)
Ref Sequence ENSEMBL: ENSMUSP00000063812 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070725] [ENSMUST00000070735] [ENSMUST00000109290]
AlphaFold P22723
Predicted Effect probably damaging
Transcript: ENSMUST00000070725
AA Change: V226I

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000064739
Gene: ENSMUSG00000020436
AA Change: V226I

DomainStartEndE-ValueType
signal peptide 1 38 N/A INTRINSIC
Pfam:Neur_chan_LBD 65 271 2.7e-55 PFAM
Pfam:Neur_chan_memb 278 408 1.8e-46 PFAM
transmembrane domain 442 464 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000070735
AA Change: V226I

PolyPhen 2 Score 0.792 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000063812
Gene: ENSMUSG00000020436
AA Change: V226I

DomainStartEndE-ValueType
signal peptide 1 38 N/A INTRINSIC
Pfam:Neur_chan_LBD 65 271 2.9e-53 PFAM
Pfam:Neur_chan_memb 278 419 2.2e-38 PFAM
transmembrane domain 450 472 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109290
AA Change: V226I

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000104913
Gene: ENSMUSG00000020436
AA Change: V226I

DomainStartEndE-ValueType
signal peptide 1 38 N/A INTRINSIC
Pfam:Neur_chan_LBD 65 271 1.2e-55 PFAM
Pfam:Neur_chan_memb 278 381 4.3e-44 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a gamma-aminobutyric acid (GABA)-A receptor subunit, which is a member of the ligand-gated ion channel family. GABA is the major inhibitory neurotransmitter in the adult central nervous system, and conversely exhibits an excitatory function during development. GABA-A receptors are pentameric, consisting of proteins from several subunit classes: alpha, beta, gamma, delta and rho. This gene encodes one of three gamma subunits in mammals, which contain the binding site for benzodiazepine drugs. Several mutations in this gene are associated with epileptic seizures, and genetic knockdown is associated with anxiety behavior. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit retarded postnatal growth, impaired sensorimotor function, and greatly reduced lifespan. Heterozygotes show enhanced anxiety-related behaviors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210016F16Rik T A 13: 58,381,835 H321L probably damaging Het
Adamts3 T C 5: 89,861,397 S136G probably benign Het
Apba3 T A 10: 81,272,346 N445K probably damaging Het
Aqp6 A G 15: 99,603,771 K237E possibly damaging Het
Arhgap23 A G 11: 97,500,343 T1229A probably benign Het
Bpifb1 T C 2: 154,214,151 I379T probably damaging Het
Ccdc169 A G 3: 55,140,109 D7G probably damaging Het
Cyp2f2 T A 7: 27,131,359 probably null Het
Daam2 T A 17: 49,480,727 K453* probably null Het
Dennd4c T C 4: 86,811,612 L817P probably damaging Het
Efcab6 T A 15: 83,870,988 R1376W probably damaging Het
Esrra G T 19: 6,913,846 A182E possibly damaging Het
Fam234b T A 6: 135,226,876 V392E probably damaging Het
Fanca A G 8: 123,271,260 V1229A probably benign Het
Fdps G T 3: 89,099,386 Q66K probably benign Het
Fer1l6 T A 15: 58,627,589 D1269E probably benign Het
Foxred1 G A 9: 35,205,636 R353W probably damaging Het
Gcnt2 C A 13: 40,860,867 C171* probably null Het
Glyat C A 19: 12,639,808 A8E probably damaging Het
Golgb1 C A 16: 36,875,396 R86S unknown Het
Hc T A 2: 35,050,419 T136S probably damaging Het
Hdac1 G T 4: 129,517,466 S421* probably null Het
Hmcn2 G T 2: 31,356,286 A756S possibly damaging Het
Igkv8-26 A G 6: 70,193,587 N54S probably benign Het
Impad1 G A 4: 4,778,207 T177I probably damaging Het
Itgae T A 11: 73,121,960 V706E possibly damaging Het
Itgax G A 7: 128,148,090 V992M probably damaging Het
Klk10 A G 7: 43,784,427 D221G probably benign Het
Klkb1 T C 8: 45,278,113 I205V probably benign Het
Kpna2 T C 11: 106,998,757 N8S probably null Het
L3mbtl1 A C 2: 162,964,514 T442P possibly damaging Het
Lrp1b C T 2: 40,661,549 C4181Y Het
Mcat T C 15: 83,547,671 Y332C probably damaging Het
Mecom T C 3: 29,956,385 D648G probably damaging Het
Mesp2 A T 7: 79,810,969 D14V probably damaging Het
Mlh3 A T 12: 85,268,199 Y404* probably null Het
Mterf3 A T 13: 66,917,148 F230I probably damaging Het
Nrxn3 T C 12: 89,512,062 V602A probably benign Het
Olfr1247 T A 2: 89,609,227 I292F possibly damaging Het
Plekhg6 A G 6: 125,374,660 F209L probably damaging Het
Pmp22 C A 11: 63,158,348 A139D probably damaging Het
Polr2e T C 10: 80,038,570 D34G possibly damaging Het
Ppard T A 17: 28,297,117 L105H probably damaging Het
Ptpn14 T A 1: 189,850,745 D596E probably benign Het
Ptprz1 C T 6: 23,002,519 A1536V not run Het
Rabgap1 TGGGG TGGG 2: 37,502,896 probably null Het
Retreg1 T A 15: 25,971,641 D222E probably benign Het
Rmnd1 T C 10: 4,413,404 K282R probably benign Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Sall3 C T 18: 80,972,052 R887H possibly damaging Het
Samd3 A G 10: 26,263,813 D281G probably benign Het
Scube1 T A 15: 83,613,452 D766V probably damaging Het
Sec24b TGC TGCAGC 3: 130,040,811 probably benign Het
Slc2a2 A G 3: 28,698,017 M1V probably null Het
Slc39a2 A T 14: 51,895,031 T144S probably benign Het
Slc5a9 T C 4: 111,877,740 H619R probably benign Het
Slco4a1 T C 2: 180,471,255 F427L probably benign Het
Snapc3 C A 4: 83,417,836 Y28* probably null Het
St3gal6 C T 16: 58,473,437 R243H probably benign Het
Stat2 T A 10: 128,277,197 N119K possibly damaging Het
Syne2 G C 12: 75,966,371 V2779L probably benign Het
Tacc1 T A 8: 25,201,285 M1L probably damaging Het
Tbc1d32 A T 10: 56,151,833 F724L possibly damaging Het
Ttc23l A G 15: 10,533,680 I259T possibly damaging Het
Ucn2 T C 9: 108,986,224 I18T probably benign Het
Wdr35 G C 12: 9,024,886 A1000P probably benign Het
Wnk1 C A 6: 119,929,828 C244F possibly damaging Het
Zeb2 T G 2: 44,994,613 D1022A probably damaging Het
Zfp26 A T 9: 20,437,833 H478Q probably damaging Het
Zfp410 A G 12: 84,331,856 K265R probably benign Het
Zfp575 T C 7: 24,586,668 D21G probably benign Het
Other mutations in Gabrg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00640:Gabrg2 APN 11 41971772 missense possibly damaging 0.87
IGL00787:Gabrg2 APN 11 41912522 missense probably benign 0.00
IGL01941:Gabrg2 APN 11 41971721 missense probably damaging 1.00
IGL02801:Gabrg2 APN 11 41912393 missense probably damaging 1.00
R0376:Gabrg2 UTSW 11 41916315 missense possibly damaging 0.92
R1607:Gabrg2 UTSW 11 41976663 missense probably damaging 0.98
R1934:Gabrg2 UTSW 11 41920470 missense probably benign 0.10
R2226:Gabrg2 UTSW 11 41971908 missense probably damaging 1.00
R2281:Gabrg2 UTSW 11 41976636 missense possibly damaging 0.72
R4013:Gabrg2 UTSW 11 41971880 missense possibly damaging 0.83
R4675:Gabrg2 UTSW 11 41968823 missense probably damaging 1.00
R4869:Gabrg2 UTSW 11 41920404 missense probably damaging 1.00
R5282:Gabrg2 UTSW 11 41971732 missense probably damaging 1.00
R5316:Gabrg2 UTSW 11 41976558 missense probably damaging 1.00
R5729:Gabrg2 UTSW 11 41967623 missense probably damaging 1.00
R5876:Gabrg2 UTSW 11 41968820 missense probably damaging 1.00
R6279:Gabrg2 UTSW 11 42000523 splice site probably null
R6300:Gabrg2 UTSW 11 42000523 splice site probably null
R6315:Gabrg2 UTSW 11 41971861 missense probably damaging 0.99
R7181:Gabrg2 UTSW 11 41920434 missense probably damaging 1.00
R7182:Gabrg2 UTSW 11 41920506 missense probably damaging 0.98
R7368:Gabrg2 UTSW 11 41976563 nonsense probably null
R7568:Gabrg2 UTSW 11 41916292 missense probably benign 0.05
R7901:Gabrg2 UTSW 11 41976591 missense probably benign 0.00
R7940:Gabrg2 UTSW 11 41967647 missense probably benign 0.06
R8250:Gabrg2 UTSW 11 41967552 missense probably benign 0.00
R8899:Gabrg2 UTSW 11 41976550 nonsense probably null
R9043:Gabrg2 UTSW 11 41974835 missense probably damaging 0.98
R9382:Gabrg2 UTSW 11 41967606 missense probably benign 0.43
R9720:Gabrg2 UTSW 11 41971846 missense probably damaging 1.00
X0065:Gabrg2 UTSW 11 41912369 missense probably damaging 1.00
Z1191:Gabrg2 UTSW 11 41916277 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCTCTGCAACTAGAATACCAGC -3'
(R):5'- GAGGCAAATTCCACAAGGC -3'

Sequencing Primer
(F):5'- ACTAGAATACCAGCTATCATTTTGTC -3'
(R):5'- GCCAGTCCAGTGTGCTCATATG -3'
Posted On 2019-10-24