Incidental Mutation 'R7599:Gabrg2'
ID 587917
Institutional Source Beutler Lab
Gene Symbol Gabrg2
Ensembl Gene ENSMUSG00000020436
Gene Name gamma-aminobutyric acid type A receptor, subunit gamma 2
Synonyms GABAA-R, Gabrg-2, gamma2
MMRRC Submission 045673-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.164) question?
Stock # R7599 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 41801030-41891684 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 41858451 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 226 (V226I)
Ref Sequence ENSEMBL: ENSMUSP00000063812 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070725] [ENSMUST00000070735] [ENSMUST00000109290]
AlphaFold P22723
Predicted Effect probably damaging
Transcript: ENSMUST00000070725
AA Change: V226I

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000064739
Gene: ENSMUSG00000020436
AA Change: V226I

DomainStartEndE-ValueType
signal peptide 1 38 N/A INTRINSIC
Pfam:Neur_chan_LBD 65 271 2.7e-55 PFAM
Pfam:Neur_chan_memb 278 408 1.8e-46 PFAM
transmembrane domain 442 464 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000070735
AA Change: V226I

PolyPhen 2 Score 0.792 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000063812
Gene: ENSMUSG00000020436
AA Change: V226I

DomainStartEndE-ValueType
signal peptide 1 38 N/A INTRINSIC
Pfam:Neur_chan_LBD 65 271 2.9e-53 PFAM
Pfam:Neur_chan_memb 278 419 2.2e-38 PFAM
transmembrane domain 450 472 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109290
AA Change: V226I

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000104913
Gene: ENSMUSG00000020436
AA Change: V226I

DomainStartEndE-ValueType
signal peptide 1 38 N/A INTRINSIC
Pfam:Neur_chan_LBD 65 271 1.2e-55 PFAM
Pfam:Neur_chan_memb 278 381 4.3e-44 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a gamma-aminobutyric acid (GABA)-A receptor subunit, which is a member of the ligand-gated ion channel family. GABA is the major inhibitory neurotransmitter in the adult central nervous system, and conversely exhibits an excitatory function during development. GABA-A receptors are pentameric, consisting of proteins from several subunit classes: alpha, beta, gamma, delta and rho. This gene encodes one of three gamma subunits in mammals, which contain the binding site for benzodiazepine drugs. Several mutations in this gene are associated with epileptic seizures, and genetic knockdown is associated with anxiety behavior. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit retarded postnatal growth, impaired sensorimotor function, and greatly reduced lifespan. Heterozygotes show enhanced anxiety-related behaviors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts3 T C 5: 90,009,256 (GRCm39) S136G probably benign Het
Apba3 T A 10: 81,108,180 (GRCm39) N445K probably damaging Het
Aqp6 A G 15: 99,501,652 (GRCm39) K237E possibly damaging Het
Arhgap23 A G 11: 97,391,169 (GRCm39) T1229A probably benign Het
Bpifb1 T C 2: 154,056,071 (GRCm39) I379T probably damaging Het
Bpnt2 G A 4: 4,778,207 (GRCm39) T177I probably damaging Het
Ccdc169 A G 3: 55,047,530 (GRCm39) D7G probably damaging Het
Cyp2f2 T A 7: 26,830,784 (GRCm39) probably null Het
Daam2 T A 17: 49,787,755 (GRCm39) K453* probably null Het
Dennd4c T C 4: 86,729,849 (GRCm39) L817P probably damaging Het
Efcab6 T A 15: 83,755,189 (GRCm39) R1376W probably damaging Het
Esrra G T 19: 6,891,214 (GRCm39) A182E possibly damaging Het
Fam234b T A 6: 135,203,874 (GRCm39) V392E probably damaging Het
Fanca A G 8: 123,997,999 (GRCm39) V1229A probably benign Het
Fdps G T 3: 89,006,693 (GRCm39) Q66K probably benign Het
Fer1l6 T A 15: 58,499,438 (GRCm39) D1269E probably benign Het
Foxred1 G A 9: 35,116,932 (GRCm39) R353W probably damaging Het
Gcnt2 C A 13: 41,014,343 (GRCm39) C171* probably null Het
Glyat C A 19: 12,617,172 (GRCm39) A8E probably damaging Het
Golgb1 C A 16: 36,695,758 (GRCm39) R86S unknown Het
Hc T A 2: 34,940,431 (GRCm39) T136S probably damaging Het
Hdac1 G T 4: 129,411,259 (GRCm39) S421* probably null Het
Hmcn2 G T 2: 31,246,298 (GRCm39) A756S possibly damaging Het
Igkv8-26 A G 6: 70,170,571 (GRCm39) N54S probably benign Het
Itgae T A 11: 73,012,786 (GRCm39) V706E possibly damaging Het
Itgax G A 7: 127,747,262 (GRCm39) V992M probably damaging Het
Klk10 A G 7: 43,433,851 (GRCm39) D221G probably benign Het
Klkb1 T C 8: 45,731,150 (GRCm39) I205V probably benign Het
Kpna2 T C 11: 106,889,583 (GRCm39) N8S probably null Het
L3mbtl1 A C 2: 162,806,434 (GRCm39) T442P possibly damaging Het
Lrp1b C T 2: 40,551,561 (GRCm39) C4181Y Het
Mcat T C 15: 83,431,872 (GRCm39) Y332C probably damaging Het
Mecom T C 3: 30,010,534 (GRCm39) D648G probably damaging Het
Mesp2 A T 7: 79,460,717 (GRCm39) D14V probably damaging Het
Mlh3 A T 12: 85,314,973 (GRCm39) Y404* probably null Het
Mterf3 A T 13: 67,065,212 (GRCm39) F230I probably damaging Het
Nrxn3 T C 12: 89,478,832 (GRCm39) V602A probably benign Het
Or4a74 T A 2: 89,439,571 (GRCm39) I292F possibly damaging Het
Plekhg6 A G 6: 125,351,623 (GRCm39) F209L probably damaging Het
Pmp22 C A 11: 63,049,174 (GRCm39) A139D probably damaging Het
Polr2e T C 10: 79,874,404 (GRCm39) D34G possibly damaging Het
Ppard T A 17: 28,516,091 (GRCm39) L105H probably damaging Het
Ptpn14 T A 1: 189,582,942 (GRCm39) D596E probably benign Het
Ptprz1 C T 6: 23,002,518 (GRCm39) A1536V not run Het
Qng1 T A 13: 58,529,649 (GRCm39) H321L probably damaging Het
Rabgap1 TGGGG TGGG 2: 37,392,908 (GRCm39) probably null Het
Retreg1 T A 15: 25,971,727 (GRCm39) D222E probably benign Het
Rmnd1 T C 10: 4,363,404 (GRCm39) K282R probably benign Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,229,111 (GRCm39) probably benign Het
Sall3 C T 18: 81,015,267 (GRCm39) R887H possibly damaging Het
Samd3 A G 10: 26,139,711 (GRCm39) D281G probably benign Het
Scube1 T A 15: 83,497,653 (GRCm39) D766V probably damaging Het
Sec24b TGC TGCAGC 3: 129,834,460 (GRCm39) probably benign Het
Slc2a2 A G 3: 28,752,166 (GRCm39) M1V probably null Het
Slc39a2 A T 14: 52,132,488 (GRCm39) T144S probably benign Het
Slc5a9 T C 4: 111,734,937 (GRCm39) H619R probably benign Het
Slco4a1 T C 2: 180,113,048 (GRCm39) F427L probably benign Het
Snapc3 C A 4: 83,336,073 (GRCm39) Y28* probably null Het
St3gal6 C T 16: 58,293,800 (GRCm39) R243H probably benign Het
Stat2 T A 10: 128,113,066 (GRCm39) N119K possibly damaging Het
Syne2 G C 12: 76,013,145 (GRCm39) V2779L probably benign Het
Tacc1 T A 8: 25,691,301 (GRCm39) M1L probably damaging Het
Tbc1d32 A T 10: 56,027,929 (GRCm39) F724L possibly damaging Het
Ttc23l A G 15: 10,533,766 (GRCm39) I259T possibly damaging Het
Ucn2 T C 9: 108,815,292 (GRCm39) I18T probably benign Het
Wdr35 G C 12: 9,074,886 (GRCm39) A1000P probably benign Het
Wnk1 C A 6: 119,906,789 (GRCm39) C244F possibly damaging Het
Zeb2 T G 2: 44,884,625 (GRCm39) D1022A probably damaging Het
Zfp26 A T 9: 20,349,129 (GRCm39) H478Q probably damaging Het
Zfp410 A G 12: 84,378,630 (GRCm39) K265R probably benign Het
Zfp575 T C 7: 24,286,093 (GRCm39) D21G probably benign Het
Other mutations in Gabrg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00640:Gabrg2 APN 11 41,862,599 (GRCm39) missense possibly damaging 0.87
IGL00787:Gabrg2 APN 11 41,803,349 (GRCm39) missense probably benign 0.00
IGL01941:Gabrg2 APN 11 41,862,548 (GRCm39) missense probably damaging 1.00
IGL02801:Gabrg2 APN 11 41,803,220 (GRCm39) missense probably damaging 1.00
R0376:Gabrg2 UTSW 11 41,807,142 (GRCm39) missense possibly damaging 0.92
R1607:Gabrg2 UTSW 11 41,867,490 (GRCm39) missense probably damaging 0.98
R1934:Gabrg2 UTSW 11 41,811,297 (GRCm39) missense probably benign 0.10
R2226:Gabrg2 UTSW 11 41,862,735 (GRCm39) missense probably damaging 1.00
R2281:Gabrg2 UTSW 11 41,867,463 (GRCm39) missense possibly damaging 0.72
R4013:Gabrg2 UTSW 11 41,862,707 (GRCm39) missense possibly damaging 0.83
R4675:Gabrg2 UTSW 11 41,859,650 (GRCm39) missense probably damaging 1.00
R4869:Gabrg2 UTSW 11 41,811,231 (GRCm39) missense probably damaging 1.00
R5282:Gabrg2 UTSW 11 41,862,559 (GRCm39) missense probably damaging 1.00
R5316:Gabrg2 UTSW 11 41,867,385 (GRCm39) missense probably damaging 1.00
R5729:Gabrg2 UTSW 11 41,858,450 (GRCm39) missense probably damaging 1.00
R5876:Gabrg2 UTSW 11 41,859,647 (GRCm39) missense probably damaging 1.00
R6279:Gabrg2 UTSW 11 41,891,350 (GRCm39) splice site probably null
R6300:Gabrg2 UTSW 11 41,891,350 (GRCm39) splice site probably null
R6315:Gabrg2 UTSW 11 41,862,688 (GRCm39) missense probably damaging 0.99
R7181:Gabrg2 UTSW 11 41,811,261 (GRCm39) missense probably damaging 1.00
R7182:Gabrg2 UTSW 11 41,811,333 (GRCm39) missense probably damaging 0.98
R7368:Gabrg2 UTSW 11 41,867,390 (GRCm39) nonsense probably null
R7568:Gabrg2 UTSW 11 41,807,119 (GRCm39) missense probably benign 0.05
R7901:Gabrg2 UTSW 11 41,867,418 (GRCm39) missense probably benign 0.00
R7940:Gabrg2 UTSW 11 41,858,474 (GRCm39) missense probably benign 0.06
R8250:Gabrg2 UTSW 11 41,858,379 (GRCm39) missense probably benign 0.00
R8899:Gabrg2 UTSW 11 41,867,377 (GRCm39) nonsense probably null
R9043:Gabrg2 UTSW 11 41,865,662 (GRCm39) missense probably damaging 0.98
R9382:Gabrg2 UTSW 11 41,858,433 (GRCm39) missense probably benign 0.43
R9720:Gabrg2 UTSW 11 41,862,673 (GRCm39) missense probably damaging 1.00
X0065:Gabrg2 UTSW 11 41,803,196 (GRCm39) missense probably damaging 1.00
Z1191:Gabrg2 UTSW 11 41,807,104 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCTCTGCAACTAGAATACCAGC -3'
(R):5'- GAGGCAAATTCCACAAGGC -3'

Sequencing Primer
(F):5'- ACTAGAATACCAGCTATCATTTTGTC -3'
(R):5'- GCCAGTCCAGTGTGCTCATATG -3'
Posted On 2019-10-24