Incidental Mutation 'R7599:Itgae'
ID 587919
Institutional Source Beutler Lab
Gene Symbol Itgae
Ensembl Gene ENSMUSG00000005947
Gene Name integrin alpha E, epithelial-associated
Synonyms alpha-E1, CD103
MMRRC Submission 045673-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7599 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 72981409-73038272 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 73012786 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 706 (V706E)
Ref Sequence ENSEMBL: ENSMUSP00000006101 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006101] [ENSMUST00000102537]
AlphaFold Q60677
Predicted Effect possibly damaging
Transcript: ENSMUST00000006101
AA Change: V706E

PolyPhen 2 Score 0.615 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000006101
Gene: ENSMUSG00000005947
AA Change: V706E

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Blast:Int_alpha 36 118 1e-24 BLAST
VWA 193 380 1.13e-39 SMART
Int_alpha 448 496 1.49e-3 SMART
Int_alpha 502 559 6.83e-12 SMART
Int_alpha 565 626 1.79e-15 SMART
Int_alpha 633 685 6.29e0 SMART
transmembrane domain 1115 1137 N/A INTRINSIC
Pfam:Integrin_alpha 1138 1152 1.1e-6 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000102537
AA Change: V706E

PolyPhen 2 Score 0.615 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000099596
Gene: ENSMUSG00000005947
AA Change: V706E

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Blast:Int_alpha 36 118 5e-25 BLAST
VWA 193 380 1.13e-39 SMART
Int_alpha 448 496 1.49e-3 SMART
Int_alpha 502 559 6.83e-12 SMART
Int_alpha 565 626 1.79e-15 SMART
Int_alpha 633 685 6.29e0 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Integrins are heterodimeric integral membrane proteins composed of an alpha chain and a beta chain. This gene encodes an I-domain-containing alpha integrin that undergoes post-translational cleavage in the extracellular domain, yielding disulfide-linked heavy and light chains. In combination with the beta 7 integrin, this protein forms the E-cadherin binding integrin known as the human mucosal lymphocyte-1 antigen. This protein is preferentially expressed in human intestinal intraepithelial lymphocytes (IEL), and in addition to a role in adhesion, it may serve as an accessory molecule for IEL activation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit reductions in the numbers of intestinal and vaginal intraepithelial lymphocytes and of T lymphocytes of the lamina propria. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts3 T C 5: 90,009,256 (GRCm39) S136G probably benign Het
Apba3 T A 10: 81,108,180 (GRCm39) N445K probably damaging Het
Aqp6 A G 15: 99,501,652 (GRCm39) K237E possibly damaging Het
Arhgap23 A G 11: 97,391,169 (GRCm39) T1229A probably benign Het
Bpifb1 T C 2: 154,056,071 (GRCm39) I379T probably damaging Het
Bpnt2 G A 4: 4,778,207 (GRCm39) T177I probably damaging Het
Ccdc169 A G 3: 55,047,530 (GRCm39) D7G probably damaging Het
Cyp2f2 T A 7: 26,830,784 (GRCm39) probably null Het
Daam2 T A 17: 49,787,755 (GRCm39) K453* probably null Het
Dennd4c T C 4: 86,729,849 (GRCm39) L817P probably damaging Het
Efcab6 T A 15: 83,755,189 (GRCm39) R1376W probably damaging Het
Esrra G T 19: 6,891,214 (GRCm39) A182E possibly damaging Het
Fam234b T A 6: 135,203,874 (GRCm39) V392E probably damaging Het
Fanca A G 8: 123,997,999 (GRCm39) V1229A probably benign Het
Fdps G T 3: 89,006,693 (GRCm39) Q66K probably benign Het
Fer1l6 T A 15: 58,499,438 (GRCm39) D1269E probably benign Het
Foxred1 G A 9: 35,116,932 (GRCm39) R353W probably damaging Het
Gabrg2 C T 11: 41,858,451 (GRCm39) V226I possibly damaging Het
Gcnt2 C A 13: 41,014,343 (GRCm39) C171* probably null Het
Glyat C A 19: 12,617,172 (GRCm39) A8E probably damaging Het
Golgb1 C A 16: 36,695,758 (GRCm39) R86S unknown Het
Hc T A 2: 34,940,431 (GRCm39) T136S probably damaging Het
Hdac1 G T 4: 129,411,259 (GRCm39) S421* probably null Het
Hmcn2 G T 2: 31,246,298 (GRCm39) A756S possibly damaging Het
Igkv8-26 A G 6: 70,170,571 (GRCm39) N54S probably benign Het
Itgax G A 7: 127,747,262 (GRCm39) V992M probably damaging Het
Klk10 A G 7: 43,433,851 (GRCm39) D221G probably benign Het
Klkb1 T C 8: 45,731,150 (GRCm39) I205V probably benign Het
Kpna2 T C 11: 106,889,583 (GRCm39) N8S probably null Het
L3mbtl1 A C 2: 162,806,434 (GRCm39) T442P possibly damaging Het
Lrp1b C T 2: 40,551,561 (GRCm39) C4181Y Het
Mcat T C 15: 83,431,872 (GRCm39) Y332C probably damaging Het
Mecom T C 3: 30,010,534 (GRCm39) D648G probably damaging Het
Mesp2 A T 7: 79,460,717 (GRCm39) D14V probably damaging Het
Mlh3 A T 12: 85,314,973 (GRCm39) Y404* probably null Het
Mterf3 A T 13: 67,065,212 (GRCm39) F230I probably damaging Het
Nrxn3 T C 12: 89,478,832 (GRCm39) V602A probably benign Het
Or4a74 T A 2: 89,439,571 (GRCm39) I292F possibly damaging Het
Plekhg6 A G 6: 125,351,623 (GRCm39) F209L probably damaging Het
Pmp22 C A 11: 63,049,174 (GRCm39) A139D probably damaging Het
Polr2e T C 10: 79,874,404 (GRCm39) D34G possibly damaging Het
Ppard T A 17: 28,516,091 (GRCm39) L105H probably damaging Het
Ptpn14 T A 1: 189,582,942 (GRCm39) D596E probably benign Het
Ptprz1 C T 6: 23,002,518 (GRCm39) A1536V not run Het
Qng1 T A 13: 58,529,649 (GRCm39) H321L probably damaging Het
Rabgap1 TGGGG TGGG 2: 37,392,908 (GRCm39) probably null Het
Retreg1 T A 15: 25,971,727 (GRCm39) D222E probably benign Het
Rmnd1 T C 10: 4,363,404 (GRCm39) K282R probably benign Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,229,111 (GRCm39) probably benign Het
Sall3 C T 18: 81,015,267 (GRCm39) R887H possibly damaging Het
Samd3 A G 10: 26,139,711 (GRCm39) D281G probably benign Het
Scube1 T A 15: 83,497,653 (GRCm39) D766V probably damaging Het
Sec24b TGC TGCAGC 3: 129,834,460 (GRCm39) probably benign Het
Slc2a2 A G 3: 28,752,166 (GRCm39) M1V probably null Het
Slc39a2 A T 14: 52,132,488 (GRCm39) T144S probably benign Het
Slc5a9 T C 4: 111,734,937 (GRCm39) H619R probably benign Het
Slco4a1 T C 2: 180,113,048 (GRCm39) F427L probably benign Het
Snapc3 C A 4: 83,336,073 (GRCm39) Y28* probably null Het
St3gal6 C T 16: 58,293,800 (GRCm39) R243H probably benign Het
Stat2 T A 10: 128,113,066 (GRCm39) N119K possibly damaging Het
Syne2 G C 12: 76,013,145 (GRCm39) V2779L probably benign Het
Tacc1 T A 8: 25,691,301 (GRCm39) M1L probably damaging Het
Tbc1d32 A T 10: 56,027,929 (GRCm39) F724L possibly damaging Het
Ttc23l A G 15: 10,533,766 (GRCm39) I259T possibly damaging Het
Ucn2 T C 9: 108,815,292 (GRCm39) I18T probably benign Het
Wdr35 G C 12: 9,074,886 (GRCm39) A1000P probably benign Het
Wnk1 C A 6: 119,906,789 (GRCm39) C244F possibly damaging Het
Zeb2 T G 2: 44,884,625 (GRCm39) D1022A probably damaging Het
Zfp26 A T 9: 20,349,129 (GRCm39) H478Q probably damaging Het
Zfp410 A G 12: 84,378,630 (GRCm39) K265R probably benign Het
Zfp575 T C 7: 24,286,093 (GRCm39) D21G probably benign Het
Other mutations in Itgae
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00424:Itgae APN 11 73,036,461 (GRCm39) missense probably benign 0.17
IGL00472:Itgae APN 11 73,004,520 (GRCm39) missense probably benign 0.06
IGL00821:Itgae APN 11 73,013,974 (GRCm39) missense probably damaging 1.00
IGL01625:Itgae APN 11 73,010,263 (GRCm39) missense probably benign 0.00
IGL01639:Itgae APN 11 73,010,204 (GRCm39) missense probably benign 0.00
IGL01743:Itgae APN 11 73,002,585 (GRCm39) missense probably benign 0.02
IGL01911:Itgae APN 11 73,006,963 (GRCm39) missense probably damaging 1.00
IGL01949:Itgae APN 11 73,009,010 (GRCm39) missense probably benign 0.29
IGL02149:Itgae APN 11 72,994,720 (GRCm39) missense probably benign 0.04
IGL02179:Itgae APN 11 73,024,844 (GRCm39) missense probably benign 0.06
IGL02231:Itgae APN 11 72,981,448 (GRCm39) missense possibly damaging 0.88
IGL02292:Itgae APN 11 73,009,361 (GRCm39) missense probably damaging 0.98
IGL02378:Itgae APN 11 73,008,947 (GRCm39) missense probably benign 0.00
IGL02525:Itgae APN 11 73,021,777 (GRCm39) missense probably damaging 0.98
IGL02576:Itgae APN 11 73,009,331 (GRCm39) missense possibly damaging 0.95
IGL02729:Itgae APN 11 73,009,029 (GRCm39) splice site probably benign
IGL02859:Itgae APN 11 73,005,693 (GRCm39) missense probably damaging 1.00
IGL03074:Itgae APN 11 73,016,136 (GRCm39) missense probably benign 0.00
IGL03107:Itgae APN 11 73,004,427 (GRCm39) missense probably damaging 1.00
IGL03264:Itgae APN 11 73,006,400 (GRCm39) missense possibly damaging 0.73
IGL03272:Itgae APN 11 73,024,680 (GRCm39) splice site probably null
IGL03352:Itgae APN 11 73,022,556 (GRCm39) missense probably damaging 1.00
R0134:Itgae UTSW 11 73,002,168 (GRCm39) missense probably benign 0.00
R0225:Itgae UTSW 11 73,002,168 (GRCm39) missense probably benign 0.00
R0320:Itgae UTSW 11 73,021,825 (GRCm39) missense possibly damaging 0.74
R0344:Itgae UTSW 11 73,008,973 (GRCm39) missense probably benign 0.13
R0403:Itgae UTSW 11 73,014,009 (GRCm39) missense possibly damaging 0.89
R0631:Itgae UTSW 11 73,005,733 (GRCm39) missense probably damaging 1.00
R0833:Itgae UTSW 11 73,020,032 (GRCm39) missense probably benign 0.02
R0836:Itgae UTSW 11 73,020,032 (GRCm39) missense probably benign 0.02
R0973:Itgae UTSW 11 73,029,335 (GRCm39) nonsense probably null
R1231:Itgae UTSW 11 73,010,205 (GRCm39) missense probably benign 0.02
R1389:Itgae UTSW 11 73,016,188 (GRCm39) missense probably damaging 1.00
R1433:Itgae UTSW 11 73,006,418 (GRCm39) missense probably damaging 1.00
R1534:Itgae UTSW 11 73,036,431 (GRCm39) missense possibly damaging 0.58
R1833:Itgae UTSW 11 73,007,988 (GRCm39) missense possibly damaging 0.94
R1914:Itgae UTSW 11 73,009,469 (GRCm39) splice site probably benign
R1915:Itgae UTSW 11 73,009,469 (GRCm39) splice site probably benign
R2061:Itgae UTSW 11 73,009,448 (GRCm39) missense probably benign 0.00
R2380:Itgae UTSW 11 73,036,395 (GRCm39) missense probably benign 0.00
R2435:Itgae UTSW 11 73,012,763 (GRCm39) nonsense probably null
R2680:Itgae UTSW 11 73,005,752 (GRCm39) missense probably damaging 1.00
R2886:Itgae UTSW 11 73,031,513 (GRCm39) missense probably benign 0.04
R3873:Itgae UTSW 11 73,004,442 (GRCm39) missense probably damaging 1.00
R3923:Itgae UTSW 11 73,006,969 (GRCm39) missense probably damaging 0.99
R4010:Itgae UTSW 11 73,002,165 (GRCm39) missense probably benign 0.00
R4059:Itgae UTSW 11 73,002,960 (GRCm39) missense probably benign
R4212:Itgae UTSW 11 73,010,178 (GRCm39) missense probably benign
R4213:Itgae UTSW 11 73,010,178 (GRCm39) missense probably benign
R4691:Itgae UTSW 11 73,010,345 (GRCm39) nonsense probably null
R4736:Itgae UTSW 11 73,005,706 (GRCm39) missense possibly damaging 0.79
R5152:Itgae UTSW 11 73,021,821 (GRCm39) missense probably damaging 1.00
R5201:Itgae UTSW 11 73,001,382 (GRCm39) missense probably benign 0.00
R5307:Itgae UTSW 11 73,036,464 (GRCm39) missense probably benign 0.00
R5362:Itgae UTSW 11 73,002,675 (GRCm39) missense probably damaging 1.00
R5448:Itgae UTSW 11 73,024,734 (GRCm39) critical splice donor site probably null
R5645:Itgae UTSW 11 73,020,074 (GRCm39) missense probably damaging 1.00
R5672:Itgae UTSW 11 73,036,377 (GRCm39) missense possibly damaging 0.96
R6079:Itgae UTSW 11 73,006,400 (GRCm39) missense possibly damaging 0.73
R6138:Itgae UTSW 11 73,006,400 (GRCm39) missense possibly damaging 0.73
R6226:Itgae UTSW 11 73,031,583 (GRCm39) missense probably benign 0.11
R6244:Itgae UTSW 11 73,036,427 (GRCm39) missense probably damaging 0.96
R6326:Itgae UTSW 11 73,022,519 (GRCm39) missense possibly damaging 0.88
R6332:Itgae UTSW 11 73,002,228 (GRCm39) splice site probably null
R6502:Itgae UTSW 11 73,036,418 (GRCm39) missense probably benign 0.10
R6825:Itgae UTSW 11 73,009,322 (GRCm39) missense possibly damaging 0.89
R7016:Itgae UTSW 11 73,010,342 (GRCm39) missense probably damaging 0.99
R7020:Itgae UTSW 11 73,002,195 (GRCm39) missense probably damaging 1.00
R7069:Itgae UTSW 11 73,006,969 (GRCm39) missense probably damaging 0.99
R7132:Itgae UTSW 11 73,002,184 (GRCm39) missense possibly damaging 0.93
R7473:Itgae UTSW 11 73,031,504 (GRCm39) missense possibly damaging 0.87
R7637:Itgae UTSW 11 73,004,457 (GRCm39) missense probably damaging 1.00
R7763:Itgae UTSW 11 73,014,095 (GRCm39) critical splice donor site probably null
R7829:Itgae UTSW 11 73,029,618 (GRCm39) missense probably benign
R7860:Itgae UTSW 11 73,011,099 (GRCm39) critical splice acceptor site probably null
R7978:Itgae UTSW 11 73,024,913 (GRCm39) missense probably damaging 0.98
R8197:Itgae UTSW 11 73,011,210 (GRCm39) missense probably benign
R8911:Itgae UTSW 11 73,004,447 (GRCm39) missense probably damaging 1.00
R9155:Itgae UTSW 11 73,016,089 (GRCm39) missense possibly damaging 0.94
R9284:Itgae UTSW 11 73,012,752 (GRCm39) missense probably benign 0.25
R9355:Itgae UTSW 11 73,006,906 (GRCm39) missense probably damaging 1.00
R9414:Itgae UTSW 11 73,002,629 (GRCm39) missense possibly damaging 0.59
R9595:Itgae UTSW 11 73,016,182 (GRCm39) missense probably damaging 0.99
R9618:Itgae UTSW 11 73,011,171 (GRCm39) missense possibly damaging 0.78
U15987:Itgae UTSW 11 73,006,400 (GRCm39) missense possibly damaging 0.73
X0024:Itgae UTSW 11 73,002,202 (GRCm39) missense probably benign 0.01
Z1186:Itgae UTSW 11 72,994,713 (GRCm39) missense possibly damaging 0.74
Z1186:Itgae UTSW 11 73,024,953 (GRCm39) missense probably benign 0.36
Z1186:Itgae UTSW 11 73,012,783 (GRCm39) missense probably benign 0.00
Z1186:Itgae UTSW 11 73,012,757 (GRCm39) missense probably benign 0.00
Z1186:Itgae UTSW 11 73,008,913 (GRCm39) missense probably benign 0.01
Z1186:Itgae UTSW 11 73,006,466 (GRCm39) missense probably benign
Z1186:Itgae UTSW 11 72,994,786 (GRCm39) missense probably damaging 1.00
Z1187:Itgae UTSW 11 72,994,713 (GRCm39) missense possibly damaging 0.74
Z1187:Itgae UTSW 11 72,994,786 (GRCm39) missense probably damaging 1.00
Z1187:Itgae UTSW 11 73,006,466 (GRCm39) missense probably benign
Z1187:Itgae UTSW 11 73,008,913 (GRCm39) missense probably benign 0.01
Z1187:Itgae UTSW 11 73,012,757 (GRCm39) missense probably benign 0.00
Z1187:Itgae UTSW 11 73,012,783 (GRCm39) missense probably benign 0.00
Z1187:Itgae UTSW 11 73,024,953 (GRCm39) missense probably benign 0.36
Z1188:Itgae UTSW 11 72,994,713 (GRCm39) missense possibly damaging 0.74
Z1188:Itgae UTSW 11 73,024,953 (GRCm39) missense probably benign 0.36
Z1188:Itgae UTSW 11 73,012,783 (GRCm39) missense probably benign 0.00
Z1188:Itgae UTSW 11 73,012,757 (GRCm39) missense probably benign 0.00
Z1188:Itgae UTSW 11 73,008,913 (GRCm39) missense probably benign 0.01
Z1188:Itgae UTSW 11 73,006,466 (GRCm39) missense probably benign
Z1188:Itgae UTSW 11 72,994,786 (GRCm39) missense probably damaging 1.00
Z1189:Itgae UTSW 11 72,994,713 (GRCm39) missense possibly damaging 0.74
Z1189:Itgae UTSW 11 73,024,953 (GRCm39) missense probably benign 0.36
Z1189:Itgae UTSW 11 73,012,783 (GRCm39) missense probably benign 0.00
Z1189:Itgae UTSW 11 73,012,757 (GRCm39) missense probably benign 0.00
Z1189:Itgae UTSW 11 73,008,913 (GRCm39) missense probably benign 0.01
Z1189:Itgae UTSW 11 73,006,466 (GRCm39) missense probably benign
Z1189:Itgae UTSW 11 72,994,786 (GRCm39) missense probably damaging 1.00
Z1190:Itgae UTSW 11 73,024,953 (GRCm39) missense probably benign 0.36
Z1190:Itgae UTSW 11 73,012,783 (GRCm39) missense probably benign 0.00
Z1190:Itgae UTSW 11 73,012,757 (GRCm39) missense probably benign 0.00
Z1190:Itgae UTSW 11 73,008,913 (GRCm39) missense probably benign 0.01
Z1190:Itgae UTSW 11 73,006,466 (GRCm39) missense probably benign
Z1190:Itgae UTSW 11 72,994,786 (GRCm39) missense probably damaging 1.00
Z1190:Itgae UTSW 11 72,994,713 (GRCm39) missense possibly damaging 0.74
Z1191:Itgae UTSW 11 73,024,953 (GRCm39) missense probably benign 0.36
Z1191:Itgae UTSW 11 73,012,783 (GRCm39) missense probably benign 0.00
Z1191:Itgae UTSW 11 73,012,757 (GRCm39) missense probably benign 0.00
Z1191:Itgae UTSW 11 73,008,913 (GRCm39) missense probably benign 0.01
Z1191:Itgae UTSW 11 73,006,466 (GRCm39) missense probably benign
Z1191:Itgae UTSW 11 72,994,786 (GRCm39) missense probably damaging 1.00
Z1191:Itgae UTSW 11 72,994,713 (GRCm39) missense possibly damaging 0.74
Z1192:Itgae UTSW 11 73,012,783 (GRCm39) missense probably benign 0.00
Z1192:Itgae UTSW 11 73,012,757 (GRCm39) missense probably benign 0.00
Z1192:Itgae UTSW 11 73,008,913 (GRCm39) missense probably benign 0.01
Z1192:Itgae UTSW 11 73,006,466 (GRCm39) missense probably benign
Z1192:Itgae UTSW 11 72,994,786 (GRCm39) missense probably damaging 1.00
Z1192:Itgae UTSW 11 72,994,713 (GRCm39) missense possibly damaging 0.74
Z1192:Itgae UTSW 11 73,024,953 (GRCm39) missense probably benign 0.36
Predicted Primers PCR Primer
(F):5'- ATGTTGAATGTGGCGGAATCT -3'
(R):5'- CTTTAGGGAAAGAGGCTGTAGGA -3'

Sequencing Primer
(F):5'- CGGAATCTGTGCACTTCTCATGG -3'
(R):5'- CCCAGCTAGAGTTCTTTGGAAGAC -3'
Posted On 2019-10-24