Mutagenetix > Incidental Mutation

Incidental Mutation 'R7599:Arhgap23'

587920

Institutional Source

Beutler Lab

Gene Symbol

Arhgap23

Ensembl Gene

ENSMUSG00000049807

Gene Name

Rho GTPase activating protein 23

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7599 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

97415533-97502402 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 97500343 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 1229 (T1229A)

Ref Sequence

ENSEMBL: ENSMUSP00000112999 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000056955] [ENSMUST00000093940] [ENSMUST00000107601] [ENSMUST00000121799] [ENSMUST00000142465]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000056955

SMART Domains

Protein: ENSMUSP00000060323
Gene: ENSMUSG00000047988

Domain	Start	End	E-Value	Type
low complexity region	77	100	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000093940
AA Change: T66A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000091472
Gene: ENSMUSG00000049807
AA Change: T66A

Domain	Start	End	E-Value	Type
Blast:RhoGAP	72	123	3e-6	BLAST
low complexity region	149	162	N/A	INTRINSIC
low complexity region	173	194	N/A	INTRINSIC
low complexity region	224	242	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000107601
AA Change: T1018A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000103227
Gene: ENSMUSG00000049807
AA Change: T1018A

Domain	Start	End	E-Value	Type
low complexity region	246	258	N/A	INTRINSIC
low complexity region	354	369	N/A	INTRINSIC
low complexity region	426	443	N/A	INTRINSIC
PH	479	600	3.2e-12	SMART
low complexity region	679	687	N/A	INTRINSIC
RhoGAP	707	884	6.83e-65	SMART
low complexity region	1051	1066	N/A	INTRINSIC
low complexity region	1101	1114	N/A	INTRINSIC
low complexity region	1125	1146	N/A	INTRINSIC
low complexity region	1176	1194	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000121799
AA Change: T1229A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000112999
Gene: ENSMUSG00000049807
AA Change: T1229A

Domain	Start	End	E-Value	Type
low complexity region	8	29	N/A	INTRINSIC
PDZ	52	160	4.2e-17	SMART
low complexity region	457	469	N/A	INTRINSIC
low complexity region	565	580	N/A	INTRINSIC
low complexity region	637	654	N/A	INTRINSIC
PH	690	811	3.2e-12	SMART
low complexity region	890	898	N/A	INTRINSIC
RhoGAP	918	1095	6.83e-65	SMART
low complexity region	1262	1277	N/A	INTRINSIC
low complexity region	1312	1325	N/A	INTRINSIC
low complexity region	1336	1357	N/A	INTRINSIC
low complexity region	1387	1405	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000142465

SMART Domains

Protein: ENSMUSP00000123191
Gene: ENSMUSG00000049807

Domain	Start	End	E-Value	Type
low complexity region	54	69	N/A	INTRINSIC
low complexity region	126	143	N/A	INTRINSIC
PH	179	300	3.2e-12	SMART
low complexity region	379	387	N/A	INTRINSIC
RhoGAP	407	584	6.83e-65	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The RHO (see ARHA; MIM 165390) family of small GTPases are involved in signal transduction through transmembrane receptors, and they are inactive in the GDP-bound form and active in the GTP-bound form. GTPase-activating proteins, such as ARHGAP23, inactivate RHO family proteins by stimulating their hydrolysis of GTP (Katoh and Katoh, 2004 [PubMed 15254754]).[supplied by OMIM, Mar 2008]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2210016F16Rik	T	A	13: 58,381,835	H321L	probably damaging	Het
Adamts3	T	C	5: 89,861,397	S136G	probably benign	Het
Apba3	T	A	10: 81,272,346	N445K	probably damaging	Het
Aqp6	A	G	15: 99,603,771	K237E	possibly damaging	Het
Bpifb1	T	C	2: 154,214,151	I379T	probably damaging	Het
Ccdc169	A	G	3: 55,140,109	D7G	probably damaging	Het
Cyp2f2	T	A	7: 27,131,359		probably null	Het
Daam2	T	A	17: 49,480,727	K453*	probably null	Het
Dennd4c	T	C	4: 86,811,612	L817P	probably damaging	Het
Efcab6	T	A	15: 83,870,988	R1376W	probably damaging	Het
Esrra	G	T	19: 6,913,846	A182E	possibly damaging	Het
Fam234b	T	A	6: 135,226,876	V392E	probably damaging	Het
Fanca	A	G	8: 123,271,260	V1229A	probably benign	Het
Fdps	G	T	3: 89,099,386	Q66K	probably benign	Het
Fer1l6	T	A	15: 58,627,589	D1269E	probably benign	Het
Foxred1	G	A	9: 35,205,636	R353W	probably damaging	Het
Gabrg2	C	T	11: 41,967,624	V226I	possibly damaging	Het
Gcnt2	C	A	13: 40,860,867	C171*	probably null	Het
Glyat	C	A	19: 12,639,808	A8E	probably damaging	Het
Golgb1	C	A	16: 36,875,396	R86S	unknown	Het
Hc	T	A	2: 35,050,419	T136S	probably damaging	Het
Hdac1	G	T	4: 129,517,466	S421*	probably null	Het
Hmcn2	G	T	2: 31,356,286	A756S	possibly damaging	Het
Igkv8-26	A	G	6: 70,193,587	N54S	probably benign	Het
Impad1	G	A	4: 4,778,207	T177I	probably damaging	Het
Itgae	T	A	11: 73,121,960	V706E	possibly damaging	Het
Itgax	G	A	7: 128,148,090	V992M	probably damaging	Het
Klk10	A	G	7: 43,784,427	D221G	probably benign	Het
Klkb1	T	C	8: 45,278,113	I205V	probably benign	Het
Kpna2	T	C	11: 106,998,757	N8S	probably null	Het
L3mbtl1	A	C	2: 162,964,514	T442P	possibly damaging	Het
Lrp1b	C	T	2: 40,661,549	C4181Y		Het
Mcat	T	C	15: 83,547,671	Y332C	probably damaging	Het
Mecom	T	C	3: 29,956,385	D648G	probably damaging	Het
Mesp2	A	T	7: 79,810,969	D14V	probably damaging	Het
Mlh3	A	T	12: 85,268,199	Y404*	probably null	Het
Mterf3	A	T	13: 66,917,148	F230I	probably damaging	Het
Nrxn3	T	C	12: 89,512,062	V602A	probably benign	Het
Olfr1247	T	A	2: 89,609,227	I292F	possibly damaging	Het
Plekhg6	A	G	6: 125,374,660	F209L	probably damaging	Het
Pmp22	C	A	11: 63,158,348	A139D	probably damaging	Het
Polr2e	T	C	10: 80,038,570	D34G	possibly damaging	Het
Ppard	T	A	17: 28,297,117	L105H	probably damaging	Het
Ptpn14	T	A	1: 189,850,745	D596E	probably benign	Het
Ptprz1	C	T	6: 23,002,519	A1536V	not run	Het
Rabgap1	TGGGG	TGGG	2: 37,502,896		probably null	Het
Retreg1	T	A	15: 25,971,641	D222E	probably benign	Het
Rmnd1	T	C	10: 4,413,404	K282R	probably benign	Het
Rsf1	ATGGCG	ATGGCGACGGTGGCG	7: 97,579,904		probably benign	Het
Sall3	C	T	18: 80,972,052	R887H	possibly damaging	Het
Samd3	A	G	10: 26,263,813	D281G	probably benign	Het
Scube1	T	A	15: 83,613,452	D766V	probably damaging	Het
Sec24b	TGC	TGCAGC	3: 130,040,811		probably benign	Het
Slc2a2	A	G	3: 28,698,017	M1V	probably null	Het
Slc39a2	A	T	14: 51,895,031	T144S	probably benign	Het
Slc5a9	T	C	4: 111,877,740	H619R	probably benign	Het
Slco4a1	T	C	2: 180,471,255	F427L	probably benign	Het
Snapc3	C	A	4: 83,417,836	Y28*	probably null	Het
St3gal6	C	T	16: 58,473,437	R243H	probably benign	Het
Stat2	T	A	10: 128,277,197	N119K	possibly damaging	Het
Syne2	G	C	12: 75,966,371	V2779L	probably benign	Het
Tacc1	T	A	8: 25,201,285	M1L	probably damaging	Het
Tbc1d32	A	T	10: 56,151,833	F724L	possibly damaging	Het
Ttc23l	A	G	15: 10,533,680	I259T	possibly damaging	Het
Ucn2	T	C	9: 108,986,224	I18T	probably benign	Het
Wdr35	G	C	12: 9,024,886	A1000P	probably benign	Het
Wnk1	C	A	6: 119,929,828	C244F	possibly damaging	Het
Zeb2	T	G	2: 44,994,613	D1022A	probably damaging	Het
Zfp26	A	T	9: 20,437,833	H478Q	probably damaging	Het
Zfp410	A	G	12: 84,331,856	K265R	probably benign	Het
Zfp575	T	C	7: 24,586,668	D21G	probably benign	Het

Other mutations in Arhgap23

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00485:Arhgap23	APN	11	97492671	intron	probably benign
IGL00493:Arhgap23	APN	11	97446553	critical splice donor site	probably null
IGL01729:Arhgap23	APN	11	97453961	missense	probably damaging	1.00
IGL01805:Arhgap23	APN	11	97492602	intron	probably benign
IGL02005:Arhgap23	APN	11	97491219	missense	probably damaging	0.99
IGL02026:Arhgap23	APN	11	97451581	missense	probably damaging	0.99
IGL02135:Arhgap23	APN	11	97451702	missense	probably damaging	0.97
IGL02178:Arhgap23	APN	11	97452353	missense	probably benign	0.42
IGL02226:Arhgap23	APN	11	97451600	missense	probably benign	0.07
IGL02309:Arhgap23	APN	11	97466001	splice site	probably benign
IGL02399:Arhgap23	APN	11	97491005	intron	probably benign
IGL02630:Arhgap23	APN	11	97454297	missense	probably benign	0.24
IGL02724:Arhgap23	APN	11	97491179	missense	probably damaging	0.99
IGL02740:Arhgap23	APN	11	97475017	missense	probably damaging	1.00
IGL02746:Arhgap23	APN	11	97454204	splice site	probably benign
IGL02862:Arhgap23	APN	11	97456480	missense	probably damaging	1.00
IGL03380:Arhgap23	APN	11	97452518	missense	probably damaging	1.00
R0091:Arhgap23	UTSW	11	97452244	missense	probably benign	0.44
R0134:Arhgap23	UTSW	11	97444328	missense	probably benign	0.09
R0225:Arhgap23	UTSW	11	97444328	missense	probably benign	0.09
R0305:Arhgap23	UTSW	11	97501109	missense	probably damaging	0.99
R0358:Arhgap23	UTSW	11	97463588	missense	probably damaging	1.00
R0422:Arhgap23	UTSW	11	97463652	missense	probably damaging	1.00
R0497:Arhgap23	UTSW	11	97452163	missense	probably damaging	1.00
R0580:Arhgap23	UTSW	11	97446536	frame shift	probably null
R0782:Arhgap23	UTSW	11	97500554	missense	possibly damaging	0.73
R1216:Arhgap23	UTSW	11	97492672	intron	probably benign
R1488:Arhgap23	UTSW	11	97500859	missense	possibly damaging	0.53
R1785:Arhgap23	UTSW	11	97451561	missense	possibly damaging	0.77
R1844:Arhgap23	UTSW	11	97463408	missense	probably damaging	1.00
R1855:Arhgap23	UTSW	11	97448697	missense	probably damaging	0.99
R1977:Arhgap23	UTSW	11	97451447	missense	possibly damaging	0.95
R2064:Arhgap23	UTSW	11	97493062	missense	probably benign	0.02
R2130:Arhgap23	UTSW	11	97451561	missense	possibly damaging	0.77
R2431:Arhgap23	UTSW	11	97452404	missense	probably benign
R2853:Arhgap23	UTSW	11	97492594	splice site	probably null
R3767:Arhgap23	UTSW	11	97476106	missense	probably damaging	1.00
R3768:Arhgap23	UTSW	11	97476106	missense	probably damaging	1.00
R3769:Arhgap23	UTSW	11	97476106	missense	probably damaging	1.00
R3770:Arhgap23	UTSW	11	97476106	missense	probably damaging	1.00
R4209:Arhgap23	UTSW	11	97454496	missense	probably damaging	0.99
R4247:Arhgap23	UTSW	11	97463699	missense	probably damaging	1.00
R4997:Arhgap23	UTSW	11	97452020	missense	probably damaging	0.98
R5399:Arhgap23	UTSW	11	97500917	missense	probably damaging	0.97
R5549:Arhgap23	UTSW	11	97466568	missense	probably damaging	0.96
R5655:Arhgap23	UTSW	11	97452546	critical splice donor site	probably null
R5857:Arhgap23	UTSW	11	97451579	missense	possibly damaging	0.93
R6013:Arhgap23	UTSW	11	97500992	missense	probably damaging	0.99
R6031:Arhgap23	UTSW	11	97476139	missense	probably damaging	1.00
R6031:Arhgap23	UTSW	11	97476139	missense	probably damaging	1.00
R6077:Arhgap23	UTSW	11	97491232	critical splice donor site	probably null
R6151:Arhgap23	UTSW	11	97500412	missense	probably benign	0.01
R6393:Arhgap23	UTSW	11	97463672	missense	probably damaging	0.98
R6693:Arhgap23	UTSW	11	97466517	missense	probably damaging	1.00
R6752:Arhgap23	UTSW	11	97452248	missense	probably damaging	0.98
R7202:Arhgap23	UTSW	11	97451993	missense	possibly damaging	0.65
R7209:Arhgap23	UTSW	11	97476085	missense	probably damaging	1.00
R7209:Arhgap23	UTSW	11	97492447	splice site	probably null
R7320:Arhgap23	UTSW	11	97451545	missense	probably benign	0.10
R7345:Arhgap23	UTSW	11	97466478	missense	possibly damaging	0.91
R8229:Arhgap23	UTSW	11	97453906	missense	probably benign	0.36
R8332:Arhgap23	UTSW	11	97491134	missense	unknown
R8412:Arhgap23	UTSW	11	97466028	missense	probably benign	0.02
R8460:Arhgap23	UTSW	11	97452371	missense	probably damaging	1.00
R8492:Arhgap23	UTSW	11	97475021	missense	probably damaging	1.00
R8525:Arhgap23	UTSW	11	97490084	missense	probably damaging	1.00
R8692:Arhgap23	UTSW	11	97454496	missense	probably damaging	0.99
R8708:Arhgap23	UTSW	11	97452412	missense	probably benign	0.06
R8749:Arhgap23	UTSW	11	97500815	missense	probably damaging	0.99
R8882:Arhgap23	UTSW	11	97465123	missense	probably benign	0.00
R9188:Arhgap23	UTSW	11	97500157	missense	possibly damaging	0.72
RF020:Arhgap23	UTSW	11	97463561	missense	probably damaging	1.00
V8831:Arhgap23	UTSW	11	97456545	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- GATGCTGGCGATCTCCTTCATC -3'
(R):5'- TCGCATGGCATGAGATGGTG -3'

Sequencing Primer
(F):5'- TTCATCTCTGCGGTCAACC -3'
(R):5'- TGTGAGCTGAAGGATGGCC -3'

Posted On

2019-10-24