Incidental Mutation 'R7599:Kpna2'
ID587921
Institutional Source Beutler Lab
Gene Symbol Kpna2
Ensembl Gene ENSMUSG00000018362
Gene Namekaryopherin (importin) alpha 2
Synonyms2410044B12Rik, pendulin, m-importin-alpha-P1, m-importin, Rch1, Importin alpha
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.949) question?
Stock #R7599 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location106988629-106999541 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 106998757 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 8 (N8S)
Ref Sequence ENSEMBL: ENSMUSP00000118679 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018506] [ENSMUST00000106768] [ENSMUST00000124541] [ENSMUST00000140362] [ENSMUST00000144834] [ENSMUST00000145331]
Predicted Effect probably benign
Transcript: ENSMUST00000018506
SMART Domains Protein: ENSMUSP00000018506
Gene: ENSMUSG00000018362

DomainStartEndE-ValueType
Pfam:IBB 9 98 2.8e-32 PFAM
ARM 108 149 8.95e-7 SMART
ARM 151 191 1.33e-9 SMART
ARM 193 231 2.7e-1 SMART
ARM 241 280 1.74e-4 SMART
ARM 282 322 1.92e-6 SMART
ARM 324 364 2.76e-7 SMART
ARM 366 406 3.45e-8 SMART
ARM 409 449 2.17e-5 SMART
Pfam:Arm_3 458 509 3.6e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106768
SMART Domains Protein: ENSMUSP00000102379
Gene: ENSMUSG00000018362

DomainStartEndE-ValueType
Pfam:IBB 5 79 4.9e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124541
SMART Domains Protein: ENSMUSP00000114636
Gene: ENSMUSG00000018362

DomainStartEndE-ValueType
Pfam:IBB 5 99 5.7e-29 PFAM
Pfam:Arm 108 149 4.6e-10 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000140362
AA Change: N8S
SMART Domains Protein: ENSMUSP00000118679
Gene: ENSMUSG00000018362
AA Change: N8S

DomainStartEndE-ValueType
Pfam:IBB 24 118 9.7e-30 PFAM
Pfam:Arm 127 168 1.4e-10 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000144834
SMART Domains Protein: ENSMUSP00000121655
Gene: ENSMUSG00000018362

DomainStartEndE-ValueType
Pfam:IBB 5 99 5.1e-29 PFAM
Pfam:Arm 108 149 4.3e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145331
SMART Domains Protein: ENSMUSP00000122983
Gene: ENSMUSG00000018362

DomainStartEndE-ValueType
Pfam:IBB 5 74 1.9e-24 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The import of proteins into the nucleus is a process that involves at least 2 steps. The first is an energy-independent docking of the protein to the nuclear envelope and the second is an energy-dependent translocation through the nuclear pore complex. Imported proteins require a nuclear localization sequence (NLS) which generally consists of a short region of basic amino acids or 2 such regions spaced about 10 amino acids apart. Proteins involved in the first step of nuclear import have been identified in different systems. These include the Xenopus protein importin and its yeast homolog, SRP1 (a suppressor of certain temperature-sensitive mutations of RNA polymerase I in Saccharomyces cerevisiae), which bind to the NLS. KPNA2 protein interacts with the NLSs of DNA helicase Q1 and SV40 T antigen and may be involved in the nuclear transport of proteins. KPNA2 also may play a role in V(D)J recombination. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210016F16Rik T A 13: 58,381,835 H321L probably damaging Het
Adamts3 T C 5: 89,861,397 S136G probably benign Het
Apba3 T A 10: 81,272,346 N445K probably damaging Het
Aqp6 A G 15: 99,603,771 K237E possibly damaging Het
Arhgap23 A G 11: 97,500,343 T1229A probably benign Het
Bpifb1 T C 2: 154,214,151 I379T probably damaging Het
Ccdc169 A G 3: 55,140,109 D7G probably damaging Het
Cyp2f2 T A 7: 27,131,359 probably null Het
Daam2 T A 17: 49,480,727 K453* probably null Het
Dennd4c T C 4: 86,811,612 L817P probably damaging Het
Efcab6 T A 15: 83,870,988 R1376W probably damaging Het
Esrra G T 19: 6,913,846 A182E possibly damaging Het
Fam234b T A 6: 135,226,876 V392E probably damaging Het
Fanca A G 8: 123,271,260 V1229A probably benign Het
Fdps G T 3: 89,099,386 Q66K probably benign Het
Fer1l6 T A 15: 58,627,589 D1269E probably benign Het
Foxred1 G A 9: 35,205,636 R353W probably damaging Het
Gabrg2 C T 11: 41,967,624 V226I possibly damaging Het
Gcnt2 C A 13: 40,860,867 C171* probably null Het
Glyat C A 19: 12,639,808 A8E probably damaging Het
Golgb1 C A 16: 36,875,396 R86S unknown Het
Hc T A 2: 35,050,419 T136S probably damaging Het
Hdac1 G T 4: 129,517,466 S421* probably null Het
Hmcn2 G T 2: 31,356,286 A756S possibly damaging Het
Igkv8-26 A G 6: 70,193,587 N54S probably benign Het
Impad1 G A 4: 4,778,207 T177I probably damaging Het
Itgae T A 11: 73,121,960 V706E possibly damaging Het
Itgax G A 7: 128,148,090 V992M probably damaging Het
Klk10 A G 7: 43,784,427 D221G probably benign Het
Klkb1 T C 8: 45,278,113 I205V probably benign Het
L3mbtl1 A C 2: 162,964,514 T442P possibly damaging Het
Lrp1b C T 2: 40,661,549 C4181Y Het
Mcat T C 15: 83,547,671 Y332C probably damaging Het
Mecom T C 3: 29,956,385 D648G probably damaging Het
Mesp2 A T 7: 79,810,969 D14V probably damaging Het
Mlh3 A T 12: 85,268,199 Y404* probably null Het
Mterf3 A T 13: 66,917,148 F230I probably damaging Het
Nrxn3 T C 12: 89,512,062 V602A probably benign Het
Olfr1247 T A 2: 89,609,227 I292F possibly damaging Het
Plekhg6 A G 6: 125,374,660 F209L probably damaging Het
Pmp22 C A 11: 63,158,348 A139D probably damaging Het
Polr2e T C 10: 80,038,570 D34G possibly damaging Het
Ppard T A 17: 28,297,117 L105H probably damaging Het
Ptpn14 T A 1: 189,850,745 D596E probably benign Het
Ptprz1 C T 6: 23,002,519 A1536V not run Het
Rabgap1 TGGGG TGGG 2: 37,502,896 probably null Het
Retreg1 T A 15: 25,971,641 D222E probably benign Het
Rmnd1 T C 10: 4,413,404 K282R probably benign Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Sall3 C T 18: 80,972,052 R887H possibly damaging Het
Samd3 A G 10: 26,263,813 D281G probably benign Het
Scube1 T A 15: 83,613,452 D766V probably damaging Het
Sec24b TGC TGCAGC 3: 130,040,811 probably benign Het
Slc2a2 A G 3: 28,698,017 M1V probably null Het
Slc39a2 A T 14: 51,895,031 T144S probably benign Het
Slc5a9 T C 4: 111,877,740 H619R probably benign Het
Slco4a1 T C 2: 180,471,255 F427L probably benign Het
Snapc3 C A 4: 83,417,836 Y28* probably null Het
St3gal6 C T 16: 58,473,437 R243H probably benign Het
Stat2 T A 10: 128,277,197 N119K possibly damaging Het
Syne2 G C 12: 75,966,371 V2779L probably benign Het
Tacc1 T A 8: 25,201,285 M1L probably damaging Het
Tbc1d32 A T 10: 56,151,833 F724L possibly damaging Het
Ttc23l A G 15: 10,533,680 I259T possibly damaging Het
Ucn2 T C 9: 108,986,224 I18T probably benign Het
Wdr35 G C 12: 9,024,886 A1000P probably benign Het
Wnk1 C A 6: 119,929,828 C244F possibly damaging Het
Zeb2 T G 2: 44,994,613 D1022A probably damaging Het
Zfp26 A T 9: 20,437,833 H478Q probably damaging Het
Zfp410 A G 12: 84,331,856 K265R probably benign Het
Zfp575 T C 7: 24,586,668 D21G probably benign Het
Other mutations in Kpna2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01542:Kpna2 APN 11 106991201 missense probably benign 0.01
IGL02985:Kpna2 APN 11 106989337 missense probably benign 0.11
R0016:Kpna2 UTSW 11 106991086 missense probably benign
R0233:Kpna2 UTSW 11 106992631 missense probably benign 0.03
R0359:Kpna2 UTSW 11 106991322 missense probably damaging 1.00
R1450:Kpna2 UTSW 11 106997309 missense probably benign 0.05
R1750:Kpna2 UTSW 11 106991445 missense probably damaging 0.99
R4751:Kpna2 UTSW 11 106992664 missense possibly damaging 0.85
R4762:Kpna2 UTSW 11 106990259 missense probably benign 0.04
R4911:Kpna2 UTSW 11 106990719 missense probably damaging 1.00
R4952:Kpna2 UTSW 11 106991235 missense probably damaging 1.00
R4976:Kpna2 UTSW 11 106991469 missense probably damaging 1.00
R5283:Kpna2 UTSW 11 106990832 missense probably damaging 1.00
R5564:Kpna2 UTSW 11 106990745 missense probably damaging 1.00
R6870:Kpna2 UTSW 11 106992694 splice site probably null
R7606:Kpna2 UTSW 11 106992058 missense probably damaging 0.99
R7672:Kpna2 UTSW 11 106988963 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GAGAACAATCTACGTCCTTTGTTTG -3'
(R):5'- TTACCAGGGTACTTTGGGTTCC -3'

Sequencing Primer
(F):5'- CTGTGTGTATCCCTGGCTGTC -3'
(R):5'- CAGGGTACTTTGGGTTCCTGTCC -3'
Posted On2019-10-24