Incidental Mutation 'R7599:Nrxn3'
ID587926
Institutional Source Beutler Lab
Gene Symbol Nrxn3
Ensembl Gene ENSMUSG00000066392
Gene Nameneurexin III
Synonyms4933401A11Rik, 9330112C09Rik, D12Bwg0831e, neurexin III alpha, neurexin III beta, neurexin III alpha, neurexin III beta
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7599 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location88722876-90334935 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 89512062 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 602 (V602A)
Ref Sequence ENSEMBL: ENSMUSP00000050075 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057634] [ENSMUST00000163134] [ENSMUST00000167103] [ENSMUST00000167887] [ENSMUST00000190626]
PDB Structure
Crystal structure of beta-neurexin 3 without the splice insert 4 [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000057634
AA Change: V602A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000050075
Gene: ENSMUSG00000066392
AA Change: V602A

DomainStartEndE-ValueType
LamG 94 246 3.28e-41 SMART
EGF 273 307 4.1e-2 SMART
LamG 332 470 4.87e-26 SMART
LamG 518 654 7.08e-37 SMART
EGF 688 722 1.99e1 SMART
LamG 750 907 1.14e-17 SMART
low complexity region 948 964 N/A INTRINSIC
low complexity region 1028 1043 N/A INTRINSIC
4.1m 1046 1064 4.38e-5 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000163134
AA Change: V975A

PolyPhen 2 Score 0.669 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000129678
Gene: ENSMUSG00000066392
AA Change: V975A

DomainStartEndE-ValueType
LamG 47 184 9.8e-31 SMART
EGF 201 235 8.07e-1 SMART
LamG 279 413 7.19e-38 SMART
LamG 467 619 3.28e-41 SMART
EGF 646 680 4.1e-2 SMART
LamG 705 843 4.87e-26 SMART
LamG 891 1027 7.08e-37 SMART
EGF 1052 1086 1.99e1 SMART
LamG 1114 1271 1.14e-17 SMART
low complexity region 1312 1328 N/A INTRINSIC
low complexity region 1395 1406 N/A INTRINSIC
low complexity region 1499 1514 N/A INTRINSIC
4.1m 1517 1535 4.38e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167103
AA Change: V966A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000127407
Gene: ENSMUSG00000066392
AA Change: V966A

DomainStartEndE-ValueType
LamG 47 184 9.8e-31 SMART
EGF 201 235 8.07e-1 SMART
LamG 279 413 7.19e-38 SMART
LamG 467 619 3.28e-41 SMART
EGF 646 680 4.1e-2 SMART
LamG 705 834 5.76e-28 SMART
LamG 882 1018 7.08e-37 SMART
EGF 1043 1077 1.99e1 SMART
LamG 1105 1262 1.14e-17 SMART
low complexity region 1303 1319 N/A INTRINSIC
low complexity region 1354 1382 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167887
AA Change: V602A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000127926
Gene: ENSMUSG00000066392
AA Change: V602A

DomainStartEndE-ValueType
LamG 94 246 3.28e-41 SMART
EGF 273 307 4.1e-2 SMART
LamG 332 470 4.87e-26 SMART
LamG 518 654 7.08e-37 SMART
EGF 688 722 1.99e1 SMART
LamG 750 907 1.14e-17 SMART
low complexity region 948 964 N/A INTRINSIC
low complexity region 1028 1043 N/A INTRINSIC
4.1m 1046 1064 4.38e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000190626
AA Change: V602A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000139879
Gene: ENSMUSG00000066392
AA Change: V602A

DomainStartEndE-ValueType
LamG 94 246 2.1e-43 SMART
EGF 273 307 2e-4 SMART
LamG 332 470 3.1e-28 SMART
LamG 518 654 4.4e-39 SMART
EGF 688 722 9.6e-2 SMART
LamG 750 877 1.1e-22 SMART
low complexity region 918 934 N/A INTRINSIC
low complexity region 972 1000 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of a family of proteins that function in the nervous system as receptors and cell adhesion molecules. Extensive alternative splicing and the use of alternative promoters results in multiple transcript variants for this gene, but the full-length nature of many of these variants has not been determined. Transcripts that initiate from an upstream promoter encode alpha isoforms, which contain epidermal growth factor-like (EGF-like) sequences and laminin G domains. Transcripts initiating from the downstream promoter encode beta isoforms, which lack EGF-like sequences. [provided by RefSeq, Dec 2012]
PHENOTYPE: Twenty percent of mice homozygous for a knock-out allele die postnatally prior to 20 days of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210016F16Rik T A 13: 58,381,835 H321L probably damaging Het
Adamts3 T C 5: 89,861,397 S136G probably benign Het
Apba3 T A 10: 81,272,346 N445K probably damaging Het
Aqp6 A G 15: 99,603,771 K237E possibly damaging Het
Arhgap23 A G 11: 97,500,343 T1229A probably benign Het
Bpifb1 T C 2: 154,214,151 I379T probably damaging Het
Ccdc169 A G 3: 55,140,109 D7G probably damaging Het
Cyp2f2 T A 7: 27,131,359 probably null Het
Daam2 T A 17: 49,480,727 K453* probably null Het
Dennd4c T C 4: 86,811,612 L817P probably damaging Het
Efcab6 T A 15: 83,870,988 R1376W probably damaging Het
Esrra G T 19: 6,913,846 A182E possibly damaging Het
Fam234b T A 6: 135,226,876 V392E probably damaging Het
Fanca A G 8: 123,271,260 V1229A probably benign Het
Fdps G T 3: 89,099,386 Q66K probably benign Het
Fer1l6 T A 15: 58,627,589 D1269E probably benign Het
Foxred1 G A 9: 35,205,636 R353W probably damaging Het
Gabrg2 C T 11: 41,967,624 V226I possibly damaging Het
Gcnt2 C A 13: 40,860,867 C171* probably null Het
Glyat C A 19: 12,639,808 A8E probably damaging Het
Golgb1 C A 16: 36,875,396 R86S unknown Het
Hc T A 2: 35,050,419 T136S probably damaging Het
Hdac1 G T 4: 129,517,466 S421* probably null Het
Hmcn2 G T 2: 31,356,286 A756S possibly damaging Het
Igkv8-26 A G 6: 70,193,587 N54S probably benign Het
Impad1 G A 4: 4,778,207 T177I probably damaging Het
Itgae T A 11: 73,121,960 V706E possibly damaging Het
Itgax G A 7: 128,148,090 V992M probably damaging Het
Klk10 A G 7: 43,784,427 D221G probably benign Het
Klkb1 T C 8: 45,278,113 I205V probably benign Het
Kpna2 T C 11: 106,998,757 N8S probably null Het
L3mbtl1 A C 2: 162,964,514 T442P possibly damaging Het
Lrp1b C T 2: 40,661,549 C4181Y Het
Mcat T C 15: 83,547,671 Y332C probably damaging Het
Mecom T C 3: 29,956,385 D648G probably damaging Het
Mesp2 A T 7: 79,810,969 D14V probably damaging Het
Mlh3 A T 12: 85,268,199 Y404* probably null Het
Mterf3 A T 13: 66,917,148 F230I probably damaging Het
Olfr1247 T A 2: 89,609,227 I292F possibly damaging Het
Plekhg6 A G 6: 125,374,660 F209L probably damaging Het
Pmp22 C A 11: 63,158,348 A139D probably damaging Het
Polr2e T C 10: 80,038,570 D34G possibly damaging Het
Ppard T A 17: 28,297,117 L105H probably damaging Het
Ptpn14 T A 1: 189,850,745 D596E probably benign Het
Ptprz1 C T 6: 23,002,519 A1536V not run Het
Rabgap1 TGGGG TGGG 2: 37,502,896 probably null Het
Retreg1 T A 15: 25,971,641 D222E probably benign Het
Rmnd1 T C 10: 4,413,404 K282R probably benign Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Sall3 C T 18: 80,972,052 R887H possibly damaging Het
Samd3 A G 10: 26,263,813 D281G probably benign Het
Scube1 T A 15: 83,613,452 D766V probably damaging Het
Sec24b TGC TGCAGC 3: 130,040,811 probably benign Het
Slc2a2 A G 3: 28,698,017 M1V probably null Het
Slc39a2 A T 14: 51,895,031 T144S probably benign Het
Slc5a9 T C 4: 111,877,740 H619R probably benign Het
Slco4a1 T C 2: 180,471,255 F427L probably benign Het
Snapc3 C A 4: 83,417,836 Y28* probably null Het
St3gal6 C T 16: 58,473,437 R243H probably benign Het
Stat2 T A 10: 128,277,197 N119K possibly damaging Het
Syne2 G C 12: 75,966,371 V2779L probably benign Het
Tacc1 T A 8: 25,201,285 M1L probably damaging Het
Tbc1d32 A T 10: 56,151,833 F724L possibly damaging Het
Ttc23l A G 15: 10,533,680 I259T possibly damaging Het
Ucn2 T C 9: 108,986,224 I18T probably benign Het
Wdr35 G C 12: 9,024,886 A1000P probably benign Het
Wnk1 C A 6: 119,929,828 C244F possibly damaging Het
Zeb2 T G 2: 44,994,613 D1022A probably damaging Het
Zfp26 A T 9: 20,437,833 H478Q probably damaging Het
Zfp410 A G 12: 84,331,856 K265R probably benign Het
Zfp575 T C 7: 24,586,668 D21G probably benign Het
Other mutations in Nrxn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00911:Nrxn3 APN 12 90204592 missense probably damaging 1.00
IGL00961:Nrxn3 APN 12 90204546 missense possibly damaging 0.95
IGL01073:Nrxn3 APN 12 89254740 missense probably benign 0.25
IGL01338:Nrxn3 APN 12 89255034 missense possibly damaging 0.86
IGL01377:Nrxn3 APN 12 89533012 critical splice donor site probably null
IGL01409:Nrxn3 APN 12 89510358 missense probably damaging 1.00
IGL01764:Nrxn3 APN 12 90204750 missense possibly damaging 0.48
IGL02063:Nrxn3 APN 12 88795795 missense possibly damaging 0.86
IGL02171:Nrxn3 APN 12 89193163 missense probably damaging 1.00
IGL02309:Nrxn3 APN 12 89976407 missense probably damaging 0.99
IGL02340:Nrxn3 APN 12 90204628 missense possibly damaging 0.82
IGL02343:Nrxn3 APN 12 88795353 missense probably damaging 1.00
IGL02600:Nrxn3 APN 12 89511912 splice site probably benign
IGL02735:Nrxn3 APN 12 89254854 missense probably benign 0.16
IGL03061:Nrxn3 APN 12 89511928 nonsense probably null
IGL03206:Nrxn3 APN 12 89260508 missense possibly damaging 0.88
IGL03337:Nrxn3 APN 12 89255020 missense probably damaging 1.00
R0098:Nrxn3 UTSW 12 89260201 missense probably damaging 1.00
R0098:Nrxn3 UTSW 12 89260201 missense probably damaging 1.00
R0144:Nrxn3 UTSW 12 89348392 missense probably damaging 1.00
R0334:Nrxn3 UTSW 12 89813642 critical splice donor site probably null
R0531:Nrxn3 UTSW 12 88795342 missense probably damaging 1.00
R0840:Nrxn3 UTSW 12 90331793 missense possibly damaging 0.68
R1324:Nrxn3 UTSW 12 89254696 missense possibly damaging 0.89
R1438:Nrxn3 UTSW 12 90332135 missense probably damaging 1.00
R1484:Nrxn3 UTSW 12 89254777 missense probably damaging 0.99
R1621:Nrxn3 UTSW 12 88795710 missense probably benign
R1637:Nrxn3 UTSW 12 89354468 missense possibly damaging 0.94
R1659:Nrxn3 UTSW 12 90332391 missense probably damaging 1.00
R1746:Nrxn3 UTSW 12 89255019 missense possibly damaging 0.63
R1801:Nrxn3 UTSW 12 90283582 missense probably damaging 1.00
R1912:Nrxn3 UTSW 12 88795342 missense probably damaging 1.00
R1940:Nrxn3 UTSW 12 89260381 missense probably damaging 0.98
R1993:Nrxn3 UTSW 12 89260411 missense possibly damaging 0.59
R2002:Nrxn3 UTSW 12 90332315 missense probably damaging 1.00
R2125:Nrxn3 UTSW 12 89260520 splice site probably null
R2179:Nrxn3 UTSW 12 89254678 missense probably damaging 1.00
R2207:Nrxn3 UTSW 12 89348312 missense probably damaging 1.00
R2284:Nrxn3 UTSW 12 89510365 missense probably damaging 1.00
R2433:Nrxn3 UTSW 12 89976392 missense probably damaging 1.00
R2969:Nrxn3 UTSW 12 89354471 missense probably damaging 1.00
R3053:Nrxn3 UTSW 12 89255101 missense probably damaging 0.99
R3076:Nrxn3 UTSW 12 89260416 missense probably damaging 1.00
R3078:Nrxn3 UTSW 12 89260416 missense probably damaging 1.00
R4033:Nrxn3 UTSW 12 89533001 missense probably damaging 1.00
R4222:Nrxn3 UTSW 12 89532992 nonsense probably null
R4321:Nrxn3 UTSW 12 90199231 missense probably damaging 1.00
R4470:Nrxn3 UTSW 12 90204741 missense probably damaging 1.00
R4471:Nrxn3 UTSW 12 90204741 missense probably damaging 1.00
R4472:Nrxn3 UTSW 12 90204741 missense probably damaging 1.00
R4686:Nrxn3 UTSW 12 89510651 missense probably damaging 0.99
R4776:Nrxn3 UTSW 12 90331956 missense possibly damaging 0.55
R4821:Nrxn3 UTSW 12 90204709 missense probably damaging 0.99
R4869:Nrxn3 UTSW 12 88795582 missense possibly damaging 0.95
R4910:Nrxn3 UTSW 12 89260360 missense possibly damaging 0.72
R4960:Nrxn3 UTSW 12 88795201 missense possibly damaging 0.79
R4990:Nrxn3 UTSW 12 89260474 missense probably damaging 1.00
R4991:Nrxn3 UTSW 12 89260474 missense probably damaging 1.00
R5057:Nrxn3 UTSW 12 89255034 missense probably damaging 0.99
R5329:Nrxn3 UTSW 12 89813584 missense possibly damaging 0.92
R5888:Nrxn3 UTSW 12 89512085 missense possibly damaging 0.91
R6249:Nrxn3 UTSW 12 89254678 missense probably damaging 1.00
R6264:Nrxn3 UTSW 12 90332237 missense probably damaging 1.00
R6373:Nrxn3 UTSW 12 89976469 missense probably damaging 1.00
R6401:Nrxn3 UTSW 12 89255000 missense possibly damaging 0.46
R6434:Nrxn3 UTSW 12 88795515 missense probably benign 0.32
R6528:Nrxn3 UTSW 12 89513049 missense probably damaging 1.00
R6612:Nrxn3 UTSW 12 89813332 intron probably benign
R6632:Nrxn3 UTSW 12 89193154 missense probably damaging 1.00
R6874:Nrxn3 UTSW 12 90332190 missense probably damaging 0.99
R7122:Nrxn3 UTSW 12 89510607 missense probably damaging 1.00
R7328:Nrxn3 UTSW 12 88795575 missense probably benign
R7352:Nrxn3 UTSW 12 88850293 missense probably benign
R7425:Nrxn3 UTSW 12 89513100 nonsense probably null
R7444:Nrxn3 UTSW 12 89510694 missense probably damaging 1.00
R7483:Nrxn3 UTSW 12 89510462 missense probably damaging 1.00
R7738:Nrxn3 UTSW 12 88850304 missense possibly damaging 0.68
R7765:Nrxn3 UTSW 12 89813484 missense probably benign 0.03
X0019:Nrxn3 UTSW 12 90199221 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCATGGACCCTGAAGCGATC -3'
(R):5'- AAGTGGGGTCTTGTATAGAAACTG -3'

Sequencing Primer
(F):5'- ACCCTGAAGCGATCGTGTG -3'
(R):5'- TAGAAACTGGATAAATGGCCTTATGG -3'
Posted On2019-10-24