Mutagenetix > Incidental Mutation

Incidental Mutation 'R7599:Gcnt2'

587927

Institutional Source

Beutler Lab

Gene Symbol

Gcnt2

Ensembl Gene

ENSMUSG00000021360

Gene Name

glucosaminyl (N-acetyl) transferase 2, I-branching enzyme

Synonyms

IGnTB, IGnT, IGnTA, IGnTC, 5330430K10Rik

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.082) question?

Stock #

R7599 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

40859754-40960892 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

C to A at 40860867 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Stop codon at position 171 (C171*)

Ref Sequence

ENSEMBL: ENSMUSP00000105820 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000110191]

AlphaFold

P97402

Predicted Effect

probably null
Transcript: ENSMUST00000110191
AA Change: C171*

SMART Domains

Protein: ENSMUSP00000105820
Gene: ENSMUSG00000021360
AA Change: C171*

Domain	Start	End	E-Value	Type
transmembrane domain	7	24	N/A	INTRINSIC
Pfam:Branch	95	357	5.2e-61	PFAM
low complexity region	377	386	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the enzyme responsible for formation of the blood group I antigen. The i and I antigens are distinguished by linear and branched poly-N-acetyllactosaminoglycans, respectively. The encoded protein is the I-branching enzyme, a beta-1,6-N-acetylglucosaminyltransferase responsible for the conversion of fetal i antigen to adult I antigen in erythrocytes during embryonic development. Mutations in this gene have been associated with adult i blood group phenotype. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele show hypoactivity, a reduced B cell number, epidermoid cyst formation in male abdominal skin, and impaired renal function with increased blood urea nitrogen and creatinine levels and vacuolization of renal tubular epithelial cells in aging mice. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2210016F16Rik	T	A	13: 58,381,835	H321L	probably damaging	Het
Adamts3	T	C	5: 89,861,397	S136G	probably benign	Het
Apba3	T	A	10: 81,272,346	N445K	probably damaging	Het
Aqp6	A	G	15: 99,603,771	K237E	possibly damaging	Het
Arhgap23	A	G	11: 97,500,343	T1229A	probably benign	Het
Bpifb1	T	C	2: 154,214,151	I379T	probably damaging	Het
Ccdc169	A	G	3: 55,140,109	D7G	probably damaging	Het
Cyp2f2	T	A	7: 27,131,359		probably null	Het
Daam2	T	A	17: 49,480,727	K453*	probably null	Het
Dennd4c	T	C	4: 86,811,612	L817P	probably damaging	Het
Efcab6	T	A	15: 83,870,988	R1376W	probably damaging	Het
Esrra	G	T	19: 6,913,846	A182E	possibly damaging	Het
Fam234b	T	A	6: 135,226,876	V392E	probably damaging	Het
Fanca	A	G	8: 123,271,260	V1229A	probably benign	Het
Fdps	G	T	3: 89,099,386	Q66K	probably benign	Het
Fer1l6	T	A	15: 58,627,589	D1269E	probably benign	Het
Foxred1	G	A	9: 35,205,636	R353W	probably damaging	Het
Gabrg2	C	T	11: 41,967,624	V226I	possibly damaging	Het
Glyat	C	A	19: 12,639,808	A8E	probably damaging	Het
Golgb1	C	A	16: 36,875,396	R86S	unknown	Het
Hc	T	A	2: 35,050,419	T136S	probably damaging	Het
Hdac1	G	T	4: 129,517,466	S421*	probably null	Het
Hmcn2	G	T	2: 31,356,286	A756S	possibly damaging	Het
Igkv8-26	A	G	6: 70,193,587	N54S	probably benign	Het
Impad1	G	A	4: 4,778,207	T177I	probably damaging	Het
Itgae	T	A	11: 73,121,960	V706E	possibly damaging	Het
Itgax	G	A	7: 128,148,090	V992M	probably damaging	Het
Klk10	A	G	7: 43,784,427	D221G	probably benign	Het
Klkb1	T	C	8: 45,278,113	I205V	probably benign	Het
Kpna2	T	C	11: 106,998,757	N8S	probably null	Het
L3mbtl1	A	C	2: 162,964,514	T442P	possibly damaging	Het
Lrp1b	C	T	2: 40,661,549	C4181Y		Het
Mcat	T	C	15: 83,547,671	Y332C	probably damaging	Het
Mecom	T	C	3: 29,956,385	D648G	probably damaging	Het
Mesp2	A	T	7: 79,810,969	D14V	probably damaging	Het
Mlh3	A	T	12: 85,268,199	Y404*	probably null	Het
Mterf3	A	T	13: 66,917,148	F230I	probably damaging	Het
Nrxn3	T	C	12: 89,512,062	V602A	probably benign	Het
Olfr1247	T	A	2: 89,609,227	I292F	possibly damaging	Het
Plekhg6	A	G	6: 125,374,660	F209L	probably damaging	Het
Pmp22	C	A	11: 63,158,348	A139D	probably damaging	Het
Polr2e	T	C	10: 80,038,570	D34G	possibly damaging	Het
Ppard	T	A	17: 28,297,117	L105H	probably damaging	Het
Ptpn14	T	A	1: 189,850,745	D596E	probably benign	Het
Ptprz1	C	T	6: 23,002,519	A1536V	not run	Het
Rabgap1	TGGGG	TGGG	2: 37,502,896		probably null	Het
Retreg1	T	A	15: 25,971,641	D222E	probably benign	Het
Rmnd1	T	C	10: 4,413,404	K282R	probably benign	Het
Rsf1	ATGGCG	ATGGCGACGGTGGCG	7: 97,579,904		probably benign	Het
Sall3	C	T	18: 80,972,052	R887H	possibly damaging	Het
Samd3	A	G	10: 26,263,813	D281G	probably benign	Het
Scube1	T	A	15: 83,613,452	D766V	probably damaging	Het
Sec24b	TGC	TGCAGC	3: 130,040,811		probably benign	Het
Slc2a2	A	G	3: 28,698,017	M1V	probably null	Het
Slc39a2	A	T	14: 51,895,031	T144S	probably benign	Het
Slc5a9	T	C	4: 111,877,740	H619R	probably benign	Het
Slco4a1	T	C	2: 180,471,255	F427L	probably benign	Het
Snapc3	C	A	4: 83,417,836	Y28*	probably null	Het
St3gal6	C	T	16: 58,473,437	R243H	probably benign	Het
Stat2	T	A	10: 128,277,197	N119K	possibly damaging	Het
Syne2	G	C	12: 75,966,371	V2779L	probably benign	Het
Tacc1	T	A	8: 25,201,285	M1L	probably damaging	Het
Tbc1d32	A	T	10: 56,151,833	F724L	possibly damaging	Het
Ttc23l	A	G	15: 10,533,680	I259T	possibly damaging	Het
Ucn2	T	C	9: 108,986,224	I18T	probably benign	Het
Wdr35	G	C	12: 9,024,886	A1000P	probably benign	Het
Wnk1	C	A	6: 119,929,828	C244F	possibly damaging	Het
Zeb2	T	G	2: 44,994,613	D1022A	probably damaging	Het
Zfp26	A	T	9: 20,437,833	H478Q	probably damaging	Het
Zfp410	A	G	12: 84,331,856	K265R	probably benign	Het
Zfp575	T	C	7: 24,586,668	D21G	probably benign	Het

Other mutations in Gcnt2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01523:Gcnt2	APN	13	40887863	missense	probably benign	0.06
IGL01693:Gcnt2	APN	13	40888073	missense	probably benign
IGL02506:Gcnt2	APN	13	40887380	missense	probably benign	0.02
IGL03184:Gcnt2	APN	13	40888184	missense	probably benign	0.01
BB001:Gcnt2	UTSW	13	40918564	nonsense	probably null
BB011:Gcnt2	UTSW	13	40918564	nonsense	probably null
PIT4472001:Gcnt2	UTSW	13	40917937	missense	probably benign	0.39
R0358:Gcnt2	UTSW	13	40860853	missense	probably damaging	0.99
R0734:Gcnt2	UTSW	13	40860521	missense	probably benign	0.00
R1863:Gcnt2	UTSW	13	40861101	missense	possibly damaging	0.95
R3103:Gcnt2	UTSW	13	40918606	missense	probably benign	0.00
R3156:Gcnt2	UTSW	13	40861178	missense	probably benign	0.36
R3893:Gcnt2	UTSW	13	40860446	missense	probably benign	0.14
R4134:Gcnt2	UTSW	13	40887807	missense	probably damaging	1.00
R4135:Gcnt2	UTSW	13	40887807	missense	probably damaging	1.00
R4279:Gcnt2	UTSW	13	40888190	missense	probably benign	0.17
R4422:Gcnt2	UTSW	13	40860525	nonsense	probably null
R4599:Gcnt2	UTSW	13	40887490	missense	probably benign
R4618:Gcnt2	UTSW	13	40958194	nonsense	probably null
R4908:Gcnt2	UTSW	13	40860734	missense	probably damaging	1.00
R5123:Gcnt2	UTSW	13	40918355	missense	probably damaging	0.99
R5291:Gcnt2	UTSW	13	40918792	missense	probably damaging	1.00
R5437:Gcnt2	UTSW	13	40861176	missense	probably damaging	1.00
R5463:Gcnt2	UTSW	13	40918174	missense	possibly damaging	0.80
R5471:Gcnt2	UTSW	13	40860719	missense	probably damaging	1.00
R5472:Gcnt2	UTSW	13	40953579	missense	probably benign	0.30
R5493:Gcnt2	UTSW	13	40953600	missense	possibly damaging	0.70
R5586:Gcnt2	UTSW	13	40860953	missense	probably damaging	1.00
R5695:Gcnt2	UTSW	13	40918199	missense	probably benign	0.03
R6244:Gcnt2	UTSW	13	40861241	missense	probably damaging	1.00
R6293:Gcnt2	UTSW	13	40918697	missense	probably damaging	1.00
R7036:Gcnt2	UTSW	13	40887556	frame shift	probably null
R7077:Gcnt2	UTSW	13	40860420	missense	probably benign
R7432:Gcnt2	UTSW	13	40887212	intron	probably benign
R7474:Gcnt2	UTSW	13	40958257	missense	probably damaging	1.00
R7508:Gcnt2	UTSW	13	40887681	missense	probably benign	0.02
R7678:Gcnt2	UTSW	13	40953719	missense	probably benign	0.01
R7806:Gcnt2	UTSW	13	40918241	missense	probably damaging	1.00
R7808:Gcnt2	UTSW	13	40860862	missense	possibly damaging	0.81
R7909:Gcnt2	UTSW	13	40860450	missense	probably benign	0.00
R7924:Gcnt2	UTSW	13	40918564	nonsense	probably null
R8110:Gcnt2	UTSW	13	40917722	start gained	probably benign
R8287:Gcnt2	UTSW	13	40860632	missense	probably damaging	1.00
R8782:Gcnt2	UTSW	13	40918753	missense	probably damaging	0.98
R8956:Gcnt2	UTSW	13	40887728	missense	probably benign	0.30
R9225:Gcnt2	UTSW	13	40860860	missense	probably damaging	1.00
R9357:Gcnt2	UTSW	13	40888256	missense	possibly damaging	0.92
Z1088:Gcnt2	UTSW	13	40918639	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTCAGGGCCATTTACATGCCC -3'
(R):5'- AATCTTGCTGTATTGTGCACG -3'

Sequencing Primer
(F):5'- CCAGAACGTCTACTGTGTGCAC -3'
(R):5'- TAACAGCTCCTGGTGGACGTAC -3'

Posted On

2019-10-24