Incidental Mutation 'R7599:Gcnt2'
ID 587927
Institutional Source Beutler Lab
Gene Symbol Gcnt2
Ensembl Gene ENSMUSG00000021360
Gene Name glucosaminyl (N-acetyl) transferase 2 (I blood group)
Synonyms 5330430K10Rik, IGnTB, IGnT, IGnTA, IGnTC
MMRRC Submission 045673-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.113) question?
Stock # R7599 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 41013417-41114368 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) C to A at 41014343 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Stop codon at position 171 (C171*)
Ref Sequence ENSEMBL: ENSMUSP00000105820 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110191]
AlphaFold P97402
Predicted Effect probably null
Transcript: ENSMUST00000110191
AA Change: C171*
SMART Domains Protein: ENSMUSP00000105820
Gene: ENSMUSG00000021360
AA Change: C171*

DomainStartEndE-ValueType
transmembrane domain 7 24 N/A INTRINSIC
Pfam:Branch 95 357 5.2e-61 PFAM
low complexity region 377 386 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the enzyme responsible for formation of the blood group I antigen. The i and I antigens are distinguished by linear and branched poly-N-acetyllactosaminoglycans, respectively. The encoded protein is the I-branching enzyme, a beta-1,6-N-acetylglucosaminyltransferase responsible for the conversion of fetal i antigen to adult I antigen in erythrocytes during embryonic development. Mutations in this gene have been associated with adult i blood group phenotype. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele show hypoactivity, a reduced B cell number, epidermoid cyst formation in male abdominal skin, and impaired renal function with increased blood urea nitrogen and creatinine levels and vacuolization of renal tubular epithelial cells in aging mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts3 T C 5: 90,009,256 (GRCm39) S136G probably benign Het
Apba3 T A 10: 81,108,180 (GRCm39) N445K probably damaging Het
Aqp6 A G 15: 99,501,652 (GRCm39) K237E possibly damaging Het
Arhgap23 A G 11: 97,391,169 (GRCm39) T1229A probably benign Het
Bpifb1 T C 2: 154,056,071 (GRCm39) I379T probably damaging Het
Bpnt2 G A 4: 4,778,207 (GRCm39) T177I probably damaging Het
Ccdc169 A G 3: 55,047,530 (GRCm39) D7G probably damaging Het
Cyp2f2 T A 7: 26,830,784 (GRCm39) probably null Het
Daam2 T A 17: 49,787,755 (GRCm39) K453* probably null Het
Dennd4c T C 4: 86,729,849 (GRCm39) L817P probably damaging Het
Efcab6 T A 15: 83,755,189 (GRCm39) R1376W probably damaging Het
Esrra G T 19: 6,891,214 (GRCm39) A182E possibly damaging Het
Fam234b T A 6: 135,203,874 (GRCm39) V392E probably damaging Het
Fanca A G 8: 123,997,999 (GRCm39) V1229A probably benign Het
Fdps G T 3: 89,006,693 (GRCm39) Q66K probably benign Het
Fer1l6 T A 15: 58,499,438 (GRCm39) D1269E probably benign Het
Foxred1 G A 9: 35,116,932 (GRCm39) R353W probably damaging Het
Gabrg2 C T 11: 41,858,451 (GRCm39) V226I possibly damaging Het
Glyat C A 19: 12,617,172 (GRCm39) A8E probably damaging Het
Golgb1 C A 16: 36,695,758 (GRCm39) R86S unknown Het
Hc T A 2: 34,940,431 (GRCm39) T136S probably damaging Het
Hdac1 G T 4: 129,411,259 (GRCm39) S421* probably null Het
Hmcn2 G T 2: 31,246,298 (GRCm39) A756S possibly damaging Het
Igkv8-26 A G 6: 70,170,571 (GRCm39) N54S probably benign Het
Itgae T A 11: 73,012,786 (GRCm39) V706E possibly damaging Het
Itgax G A 7: 127,747,262 (GRCm39) V992M probably damaging Het
Klk10 A G 7: 43,433,851 (GRCm39) D221G probably benign Het
Klkb1 T C 8: 45,731,150 (GRCm39) I205V probably benign Het
Kpna2 T C 11: 106,889,583 (GRCm39) N8S probably null Het
L3mbtl1 A C 2: 162,806,434 (GRCm39) T442P possibly damaging Het
Lrp1b C T 2: 40,551,561 (GRCm39) C4181Y Het
Mcat T C 15: 83,431,872 (GRCm39) Y332C probably damaging Het
Mecom T C 3: 30,010,534 (GRCm39) D648G probably damaging Het
Mesp2 A T 7: 79,460,717 (GRCm39) D14V probably damaging Het
Mlh3 A T 12: 85,314,973 (GRCm39) Y404* probably null Het
Mterf3 A T 13: 67,065,212 (GRCm39) F230I probably damaging Het
Nrxn3 T C 12: 89,478,832 (GRCm39) V602A probably benign Het
Or4a74 T A 2: 89,439,571 (GRCm39) I292F possibly damaging Het
Plekhg6 A G 6: 125,351,623 (GRCm39) F209L probably damaging Het
Pmp22 C A 11: 63,049,174 (GRCm39) A139D probably damaging Het
Polr2e T C 10: 79,874,404 (GRCm39) D34G possibly damaging Het
Ppard T A 17: 28,516,091 (GRCm39) L105H probably damaging Het
Ptpn14 T A 1: 189,582,942 (GRCm39) D596E probably benign Het
Ptprz1 C T 6: 23,002,518 (GRCm39) A1536V not run Het
Qng1 T A 13: 58,529,649 (GRCm39) H321L probably damaging Het
Rabgap1 TGGGG TGGG 2: 37,392,908 (GRCm39) probably null Het
Retreg1 T A 15: 25,971,727 (GRCm39) D222E probably benign Het
Rmnd1 T C 10: 4,363,404 (GRCm39) K282R probably benign Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,229,111 (GRCm39) probably benign Het
Sall3 C T 18: 81,015,267 (GRCm39) R887H possibly damaging Het
Samd3 A G 10: 26,139,711 (GRCm39) D281G probably benign Het
Scube1 T A 15: 83,497,653 (GRCm39) D766V probably damaging Het
Sec24b TGC TGCAGC 3: 129,834,460 (GRCm39) probably benign Het
Slc2a2 A G 3: 28,752,166 (GRCm39) M1V probably null Het
Slc39a2 A T 14: 52,132,488 (GRCm39) T144S probably benign Het
Slc5a9 T C 4: 111,734,937 (GRCm39) H619R probably benign Het
Slco4a1 T C 2: 180,113,048 (GRCm39) F427L probably benign Het
Snapc3 C A 4: 83,336,073 (GRCm39) Y28* probably null Het
St3gal6 C T 16: 58,293,800 (GRCm39) R243H probably benign Het
Stat2 T A 10: 128,113,066 (GRCm39) N119K possibly damaging Het
Syne2 G C 12: 76,013,145 (GRCm39) V2779L probably benign Het
Tacc1 T A 8: 25,691,301 (GRCm39) M1L probably damaging Het
Tbc1d32 A T 10: 56,027,929 (GRCm39) F724L possibly damaging Het
Ttc23l A G 15: 10,533,766 (GRCm39) I259T possibly damaging Het
Ucn2 T C 9: 108,815,292 (GRCm39) I18T probably benign Het
Wdr35 G C 12: 9,074,886 (GRCm39) A1000P probably benign Het
Wnk1 C A 6: 119,906,789 (GRCm39) C244F possibly damaging Het
Zeb2 T G 2: 44,884,625 (GRCm39) D1022A probably damaging Het
Zfp26 A T 9: 20,349,129 (GRCm39) H478Q probably damaging Het
Zfp410 A G 12: 84,378,630 (GRCm39) K265R probably benign Het
Zfp575 T C 7: 24,286,093 (GRCm39) D21G probably benign Het
Other mutations in Gcnt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01523:Gcnt2 APN 13 41,041,339 (GRCm39) missense probably benign 0.06
IGL01693:Gcnt2 APN 13 41,041,549 (GRCm39) missense probably benign
IGL02506:Gcnt2 APN 13 41,040,856 (GRCm39) missense probably benign 0.02
IGL03184:Gcnt2 APN 13 41,041,660 (GRCm39) missense probably benign 0.01
BB001:Gcnt2 UTSW 13 41,072,040 (GRCm39) nonsense probably null
BB011:Gcnt2 UTSW 13 41,072,040 (GRCm39) nonsense probably null
PIT4472001:Gcnt2 UTSW 13 41,071,413 (GRCm39) missense probably benign 0.39
R0358:Gcnt2 UTSW 13 41,014,329 (GRCm39) missense probably damaging 0.99
R0734:Gcnt2 UTSW 13 41,013,997 (GRCm39) missense probably benign 0.00
R1863:Gcnt2 UTSW 13 41,014,577 (GRCm39) missense possibly damaging 0.95
R3103:Gcnt2 UTSW 13 41,072,082 (GRCm39) missense probably benign 0.00
R3156:Gcnt2 UTSW 13 41,014,654 (GRCm39) missense probably benign 0.36
R3893:Gcnt2 UTSW 13 41,013,922 (GRCm39) missense probably benign 0.14
R4134:Gcnt2 UTSW 13 41,041,283 (GRCm39) missense probably damaging 1.00
R4135:Gcnt2 UTSW 13 41,041,283 (GRCm39) missense probably damaging 1.00
R4279:Gcnt2 UTSW 13 41,041,666 (GRCm39) missense probably benign 0.17
R4422:Gcnt2 UTSW 13 41,014,001 (GRCm39) nonsense probably null
R4599:Gcnt2 UTSW 13 41,040,966 (GRCm39) missense probably benign
R4618:Gcnt2 UTSW 13 41,111,670 (GRCm39) nonsense probably null
R4908:Gcnt2 UTSW 13 41,014,210 (GRCm39) missense probably damaging 1.00
R5123:Gcnt2 UTSW 13 41,071,831 (GRCm39) missense probably damaging 0.99
R5291:Gcnt2 UTSW 13 41,072,268 (GRCm39) missense probably damaging 1.00
R5437:Gcnt2 UTSW 13 41,014,652 (GRCm39) missense probably damaging 1.00
R5463:Gcnt2 UTSW 13 41,071,650 (GRCm39) missense possibly damaging 0.80
R5471:Gcnt2 UTSW 13 41,014,195 (GRCm39) missense probably damaging 1.00
R5472:Gcnt2 UTSW 13 41,107,055 (GRCm39) missense probably benign 0.30
R5493:Gcnt2 UTSW 13 41,107,076 (GRCm39) missense possibly damaging 0.70
R5586:Gcnt2 UTSW 13 41,014,429 (GRCm39) missense probably damaging 1.00
R5695:Gcnt2 UTSW 13 41,071,675 (GRCm39) missense probably benign 0.03
R6244:Gcnt2 UTSW 13 41,014,717 (GRCm39) missense probably damaging 1.00
R6293:Gcnt2 UTSW 13 41,072,173 (GRCm39) missense probably damaging 1.00
R7036:Gcnt2 UTSW 13 41,041,032 (GRCm39) frame shift probably null
R7077:Gcnt2 UTSW 13 41,013,896 (GRCm39) missense probably benign
R7432:Gcnt2 UTSW 13 41,040,688 (GRCm39) intron probably benign
R7474:Gcnt2 UTSW 13 41,111,733 (GRCm39) missense probably damaging 1.00
R7508:Gcnt2 UTSW 13 41,041,157 (GRCm39) missense probably benign 0.02
R7678:Gcnt2 UTSW 13 41,107,195 (GRCm39) missense probably benign 0.01
R7806:Gcnt2 UTSW 13 41,071,717 (GRCm39) missense probably damaging 1.00
R7808:Gcnt2 UTSW 13 41,014,338 (GRCm39) missense possibly damaging 0.81
R7909:Gcnt2 UTSW 13 41,013,926 (GRCm39) missense probably benign 0.00
R7924:Gcnt2 UTSW 13 41,072,040 (GRCm39) nonsense probably null
R8110:Gcnt2 UTSW 13 41,071,198 (GRCm39) start gained probably benign
R8287:Gcnt2 UTSW 13 41,014,108 (GRCm39) missense probably damaging 1.00
R8782:Gcnt2 UTSW 13 41,072,229 (GRCm39) missense probably damaging 0.98
R8956:Gcnt2 UTSW 13 41,041,204 (GRCm39) missense probably benign 0.30
R9225:Gcnt2 UTSW 13 41,014,336 (GRCm39) missense probably damaging 1.00
R9357:Gcnt2 UTSW 13 41,041,732 (GRCm39) missense possibly damaging 0.92
Z1088:Gcnt2 UTSW 13 41,072,115 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCAGGGCCATTTACATGCCC -3'
(R):5'- AATCTTGCTGTATTGTGCACG -3'

Sequencing Primer
(F):5'- CCAGAACGTCTACTGTGTGCAC -3'
(R):5'- TAACAGCTCCTGGTGGACGTAC -3'
Posted On 2019-10-24