Mutagenetix > Incidental Mutation

Incidental Mutation 'R7599:Ttc23l'

587931

Institutional Source

Beutler Lab

Gene Symbol

Ttc23l

Ensembl Gene

ENSMUSG00000022249

Gene Name

tetratricopeptide repeat domain 23-like

Synonyms

4930401A09Rik

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.066) question?

Stock #

R7599 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

10500102-10558668 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 10533680 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 259 (I259T)

Ref Sequence

ENSEMBL: ENSMUSP00000022857 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022857] [ENSMUST00000167842] [ENSMUST00000167842]

AlphaFold

A6H6E9

Predicted Effect

possibly damaging
Transcript: ENSMUST00000022857
AA Change: I259T

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000022857
Gene: ENSMUSG00000022249
AA Change: I259T

Domain	Start	End	E-Value	Type
TPR	159	192	4.21e1	SMART
Blast:TPR	208	239	2e-6	BLAST
TPR	250	283	1.4e1	SMART
low complexity region	292	303	N/A	INTRINSIC
TPR	376	409	9.53e-2	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000167842
AA Change: I259T

PolyPhen 2 Score 0.895 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000127781
Gene: ENSMUSG00000022249
AA Change: I259T

Domain	Start	End	E-Value	Type
low complexity region	18	29	N/A	INTRINSIC
Pfam:TPR_1	102	133	3.3e-6	PFAM
low complexity region	148	160	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000167842
AA Change: I259T

PolyPhen 2 Score 0.895 (Sensitivity: 0.82; Specificity: 0.94)

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2210016F16Rik	T	A	13: 58,381,835	H321L	probably damaging	Het
Adamts3	T	C	5: 89,861,397	S136G	probably benign	Het
Apba3	T	A	10: 81,272,346	N445K	probably damaging	Het
Aqp6	A	G	15: 99,603,771	K237E	possibly damaging	Het
Arhgap23	A	G	11: 97,500,343	T1229A	probably benign	Het
Bpifb1	T	C	2: 154,214,151	I379T	probably damaging	Het
Ccdc169	A	G	3: 55,140,109	D7G	probably damaging	Het
Cyp2f2	T	A	7: 27,131,359		probably null	Het
Daam2	T	A	17: 49,480,727	K453*	probably null	Het
Dennd4c	T	C	4: 86,811,612	L817P	probably damaging	Het
Efcab6	T	A	15: 83,870,988	R1376W	probably damaging	Het
Esrra	G	T	19: 6,913,846	A182E	possibly damaging	Het
Fam234b	T	A	6: 135,226,876	V392E	probably damaging	Het
Fanca	A	G	8: 123,271,260	V1229A	probably benign	Het
Fdps	G	T	3: 89,099,386	Q66K	probably benign	Het
Fer1l6	T	A	15: 58,627,589	D1269E	probably benign	Het
Foxred1	G	A	9: 35,205,636	R353W	probably damaging	Het
Gabrg2	C	T	11: 41,967,624	V226I	possibly damaging	Het
Gcnt2	C	A	13: 40,860,867	C171*	probably null	Het
Glyat	C	A	19: 12,639,808	A8E	probably damaging	Het
Golgb1	C	A	16: 36,875,396	R86S	unknown	Het
Hc	T	A	2: 35,050,419	T136S	probably damaging	Het
Hdac1	G	T	4: 129,517,466	S421*	probably null	Het
Hmcn2	G	T	2: 31,356,286	A756S	possibly damaging	Het
Igkv8-26	A	G	6: 70,193,587	N54S	probably benign	Het
Impad1	G	A	4: 4,778,207	T177I	probably damaging	Het
Itgae	T	A	11: 73,121,960	V706E	possibly damaging	Het
Itgax	G	A	7: 128,148,090	V992M	probably damaging	Het
Klk10	A	G	7: 43,784,427	D221G	probably benign	Het
Klkb1	T	C	8: 45,278,113	I205V	probably benign	Het
Kpna2	T	C	11: 106,998,757	N8S	probably null	Het
L3mbtl1	A	C	2: 162,964,514	T442P	possibly damaging	Het
Lrp1b	C	T	2: 40,661,549	C4181Y		Het
Mcat	T	C	15: 83,547,671	Y332C	probably damaging	Het
Mecom	T	C	3: 29,956,385	D648G	probably damaging	Het
Mesp2	A	T	7: 79,810,969	D14V	probably damaging	Het
Mlh3	A	T	12: 85,268,199	Y404*	probably null	Het
Mterf3	A	T	13: 66,917,148	F230I	probably damaging	Het
Nrxn3	T	C	12: 89,512,062	V602A	probably benign	Het
Olfr1247	T	A	2: 89,609,227	I292F	possibly damaging	Het
Plekhg6	A	G	6: 125,374,660	F209L	probably damaging	Het
Pmp22	C	A	11: 63,158,348	A139D	probably damaging	Het
Polr2e	T	C	10: 80,038,570	D34G	possibly damaging	Het
Ppard	T	A	17: 28,297,117	L105H	probably damaging	Het
Ptpn14	T	A	1: 189,850,745	D596E	probably benign	Het
Ptprz1	C	T	6: 23,002,519	A1536V	not run	Het
Rabgap1	TGGGG	TGGG	2: 37,502,896		probably null	Het
Retreg1	T	A	15: 25,971,641	D222E	probably benign	Het
Rmnd1	T	C	10: 4,413,404	K282R	probably benign	Het
Rsf1	ATGGCG	ATGGCGACGGTGGCG	7: 97,579,904		probably benign	Het
Sall3	C	T	18: 80,972,052	R887H	possibly damaging	Het
Samd3	A	G	10: 26,263,813	D281G	probably benign	Het
Scube1	T	A	15: 83,613,452	D766V	probably damaging	Het
Sec24b	TGC	TGCAGC	3: 130,040,811		probably benign	Het
Slc2a2	A	G	3: 28,698,017	M1V	probably null	Het
Slc39a2	A	T	14: 51,895,031	T144S	probably benign	Het
Slc5a9	T	C	4: 111,877,740	H619R	probably benign	Het
Slco4a1	T	C	2: 180,471,255	F427L	probably benign	Het
Snapc3	C	A	4: 83,417,836	Y28*	probably null	Het
St3gal6	C	T	16: 58,473,437	R243H	probably benign	Het
Stat2	T	A	10: 128,277,197	N119K	possibly damaging	Het
Syne2	G	C	12: 75,966,371	V2779L	probably benign	Het
Tacc1	T	A	8: 25,201,285	M1L	probably damaging	Het
Tbc1d32	A	T	10: 56,151,833	F724L	possibly damaging	Het
Ucn2	T	C	9: 108,986,224	I18T	probably benign	Het
Wdr35	G	C	12: 9,024,886	A1000P	probably benign	Het
Wnk1	C	A	6: 119,929,828	C244F	possibly damaging	Het
Zeb2	T	G	2: 44,994,613	D1022A	probably damaging	Het
Zfp26	A	T	9: 20,437,833	H478Q	probably damaging	Het
Zfp410	A	G	12: 84,331,856	K265R	probably benign	Het
Zfp575	T	C	7: 24,586,668	D21G	probably benign	Het

Other mutations in Ttc23l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01143:Ttc23l	APN	15	10530689	missense	probably damaging	1.00
IGL01319:Ttc23l	APN	15	10509406	splice site	probably benign
IGL01562:Ttc23l	APN	15	10551390	splice site	probably benign
IGL01969:Ttc23l	APN	15	10551434	nonsense	probably null
IGL03172:Ttc23l	APN	15	10537566	missense	probably benign	0.06
R0042:Ttc23l	UTSW	15	10551541	missense	probably damaging	1.00
R0042:Ttc23l	UTSW	15	10551541	missense	probably damaging	1.00
R0335:Ttc23l	UTSW	15	10539963	missense	probably benign	0.26
R0554:Ttc23l	UTSW	15	10530657	missense	probably benign	0.12
R0609:Ttc23l	UTSW	15	10504536	missense	probably benign
R0631:Ttc23l	UTSW	15	10539980	missense	probably damaging	1.00
R1703:Ttc23l	UTSW	15	10523658	missense	probably damaging	1.00
R2106:Ttc23l	UTSW	15	10547256	missense	probably damaging	1.00
R2220:Ttc23l	UTSW	15	10537566	missense	probably benign	0.06
R2276:Ttc23l	UTSW	15	10523592	missense	possibly damaging	0.92
R2277:Ttc23l	UTSW	15	10523592	missense	possibly damaging	0.92
R2278:Ttc23l	UTSW	15	10523592	missense	possibly damaging	0.92
R2279:Ttc23l	UTSW	15	10523592	missense	possibly damaging	0.92
R2368:Ttc23l	UTSW	15	10537562	small insertion	probably benign
R2368:Ttc23l	UTSW	15	10537566	missense	probably benign	0.06
R2420:Ttc23l	UTSW	15	10537562	small insertion	probably benign
R2420:Ttc23l	UTSW	15	10537566	missense	probably benign	0.06
R2421:Ttc23l	UTSW	15	10537566	missense	probably benign	0.06
R2422:Ttc23l	UTSW	15	10537562	small insertion	probably benign
R2422:Ttc23l	UTSW	15	10537566	missense	probably benign	0.06
R2830:Ttc23l	UTSW	15	10537562	small insertion	probably benign
R2831:Ttc23l	UTSW	15	10537562	small insertion	probably benign
R2831:Ttc23l	UTSW	15	10537566	missense	probably benign	0.06
R2979:Ttc23l	UTSW	15	10537566	missense	probably benign	0.06
R2980:Ttc23l	UTSW	15	10537562	small insertion	probably benign
R2980:Ttc23l	UTSW	15	10537566	missense	probably benign	0.06
R2981:Ttc23l	UTSW	15	10537562	small insertion	probably benign
R2981:Ttc23l	UTSW	15	10537566	missense	probably benign	0.06
R2982:Ttc23l	UTSW	15	10537562	small insertion	probably benign
R2982:Ttc23l	UTSW	15	10537566	missense	probably benign	0.06
R2983:Ttc23l	UTSW	15	10537562	small insertion	probably benign
R2983:Ttc23l	UTSW	15	10537566	missense	probably benign	0.06
R3176:Ttc23l	UTSW	15	10547232	missense	possibly damaging	0.83
R3177:Ttc23l	UTSW	15	10547232	missense	possibly damaging	0.83
R3276:Ttc23l	UTSW	15	10547232	missense	possibly damaging	0.83
R3277:Ttc23l	UTSW	15	10547232	missense	possibly damaging	0.83
R3722:Ttc23l	UTSW	15	10537562	small insertion	probably benign
R3722:Ttc23l	UTSW	15	10537566	missense	probably benign	0.06
R3743:Ttc23l	UTSW	15	10537562	small insertion	probably benign
R3743:Ttc23l	UTSW	15	10537566	missense	probably benign	0.06
R3767:Ttc23l	UTSW	15	10530695	missense	possibly damaging	0.94
R3921:Ttc23l	UTSW	15	10537562	small insertion	probably benign
R3921:Ttc23l	UTSW	15	10537563	small insertion	probably benign
R3921:Ttc23l	UTSW	15	10537566	missense	probably benign	0.06
R4091:Ttc23l	UTSW	15	10537562	small insertion	probably benign
R4091:Ttc23l	UTSW	15	10537566	missense	probably benign	0.06
R4119:Ttc23l	UTSW	15	10539920	missense	probably damaging	1.00
R4120:Ttc23l	UTSW	15	10539920	missense	probably damaging	1.00
R4373:Ttc23l	UTSW	15	10537562	small insertion	probably benign
R4373:Ttc23l	UTSW	15	10537566	missense	probably benign	0.06
R4375:Ttc23l	UTSW	15	10537562	small insertion	probably benign
R4375:Ttc23l	UTSW	15	10537566	missense	probably benign	0.06
R4376:Ttc23l	UTSW	15	10537562	small insertion	probably benign
R4376:Ttc23l	UTSW	15	10537566	missense	probably benign	0.06
R4377:Ttc23l	UTSW	15	10537562	small insertion	probably benign
R4377:Ttc23l	UTSW	15	10537566	missense	probably benign	0.06
R5002:Ttc23l	UTSW	15	10551550	missense	possibly damaging	0.95
R5106:Ttc23l	UTSW	15	10551550	missense	possibly damaging	0.95
R5107:Ttc23l	UTSW	15	10551550	missense	possibly damaging	0.95
R5109:Ttc23l	UTSW	15	10551550	missense	possibly damaging	0.95
R5156:Ttc23l	UTSW	15	10551550	missense	possibly damaging	0.95
R5157:Ttc23l	UTSW	15	10551550	missense	possibly damaging	0.95
R5160:Ttc23l	UTSW	15	10551550	missense	possibly damaging	0.95
R5161:Ttc23l	UTSW	15	10551550	missense	possibly damaging	0.95
R5259:Ttc23l	UTSW	15	10515150	missense	probably damaging	0.99
R5307:Ttc23l	UTSW	15	10533659	missense	probably damaging	1.00
R5728:Ttc23l	UTSW	15	10551550	missense	possibly damaging	0.95
R5756:Ttc23l	UTSW	15	10551550	missense	possibly damaging	0.95
R5772:Ttc23l	UTSW	15	10551469	missense	probably benign	0.01
R5793:Ttc23l	UTSW	15	10551550	missense	possibly damaging	0.95
R5794:Ttc23l	UTSW	15	10551550	missense	possibly damaging	0.95
R5847:Ttc23l	UTSW	15	10537596	missense	probably benign	0.07
R6976:Ttc23l	UTSW	15	10537580	nonsense	probably null
R7010:Ttc23l	UTSW	15	10515138	missense	probably damaging	1.00
R7342:Ttc23l	UTSW	15	10551497	missense	probably benign	0.01
R7404:Ttc23l	UTSW	15	10551577	missense	probably damaging	0.98
R7453:Ttc23l	UTSW	15	10533767	missense	probably damaging	1.00
R7584:Ttc23l	UTSW	15	10533708	missense	probably damaging	1.00
R8710:Ttc23l	UTSW	15	10539935	missense	probably damaging	1.00
R8927:Ttc23l	UTSW	15	10530634	missense	probably damaging	1.00
R8928:Ttc23l	UTSW	15	10530634	missense	probably damaging	1.00
R9101:Ttc23l	UTSW	15	10537575	missense	probably benign	0.16
R9746:Ttc23l	UTSW	15	10523643	missense	probably benign	0.01
R9782:Ttc23l	UTSW	15	10530681	missense	probably damaging	1.00
R9792:Ttc23l	UTSW	15	10537645	missense	probably benign
R9793:Ttc23l	UTSW	15	10537645	missense	probably benign
R9795:Ttc23l	UTSW	15	10537645	missense	probably benign
Z1088:Ttc23l	UTSW	15	10533667	missense	probably damaging	1.00
Z1177:Ttc23l	UTSW	15	10533633	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCTGAGAAGCAACAGGACCTG -3'
(R):5'- GTGACCTCTGAGTAACTTCCACC -3'

Sequencing Primer
(F):5'- AGCAACAGGACCTGGAGCC -3'
(R):5'- TGAGTAACTTCCACCTTCGATTC -3'

Posted On

2019-10-24