Incidental Mutation 'R7599:Retreg1'
ID 587932
Institutional Source Beutler Lab
Gene Symbol Retreg1
Ensembl Gene ENSMUSG00000022270
Gene Name reticulophagy regulator 1
Synonyms Fam134b, 1810015C04Rik
MMRRC Submission 045673-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.103) question?
Stock # R7599 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 25843266-25973773 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 25971727 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 222 (D222E)
Ref Sequence ENSEMBL: ENSMUSP00000106068 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022881] [ENSMUST00000110438] [ENSMUST00000226438] [ENSMUST00000227275] [ENSMUST00000228306] [ENSMUST00000228327] [ENSMUST00000228600]
AlphaFold Q8VE91
Predicted Effect
SMART Domains Protein: ENSMUSP00000022881
Gene: ENSMUSG00000022270
AA Change: D346E

DomainStartEndE-ValueType
low complexity region 21 45 N/A INTRINSIC
transmembrane domain 87 109 N/A INTRINSIC
transmembrane domain 179 201 N/A INTRINSIC
low complexity region 202 216 N/A INTRINSIC
low complexity region 427 442 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110438
AA Change: D222E

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000106068
Gene: ENSMUSG00000022270
AA Change: D222E

DomainStartEndE-ValueType
transmembrane domain 55 77 N/A INTRINSIC
low complexity region 78 92 N/A INTRINSIC
low complexity region 303 318 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000226438
AA Change: D230E

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
Predicted Effect probably benign
Transcript: ENSMUST00000227275
AA Change: D222E

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
Predicted Effect probably benign
Transcript: ENSMUST00000228306
AA Change: D212E

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
Predicted Effect probably benign
Transcript: ENSMUST00000228327
Predicted Effect probably benign
Transcript: ENSMUST00000228600
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cis-Golgi transmembrane protein that may be necessary for the long-term survival of nociceptive and autonomic ganglion neurons. Mutations in this gene are a cause of hereditary sensory and autonomic neuropathy type IIB (HSAN IIB), and this gene may also play a role in susceptibility to vascular dementia. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased thermal nociceptive threshold and sensory neuron degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts3 T C 5: 90,009,256 (GRCm39) S136G probably benign Het
Apba3 T A 10: 81,108,180 (GRCm39) N445K probably damaging Het
Aqp6 A G 15: 99,501,652 (GRCm39) K237E possibly damaging Het
Arhgap23 A G 11: 97,391,169 (GRCm39) T1229A probably benign Het
Bpifb1 T C 2: 154,056,071 (GRCm39) I379T probably damaging Het
Bpnt2 G A 4: 4,778,207 (GRCm39) T177I probably damaging Het
Ccdc169 A G 3: 55,047,530 (GRCm39) D7G probably damaging Het
Cyp2f2 T A 7: 26,830,784 (GRCm39) probably null Het
Daam2 T A 17: 49,787,755 (GRCm39) K453* probably null Het
Dennd4c T C 4: 86,729,849 (GRCm39) L817P probably damaging Het
Efcab6 T A 15: 83,755,189 (GRCm39) R1376W probably damaging Het
Esrra G T 19: 6,891,214 (GRCm39) A182E possibly damaging Het
Fam234b T A 6: 135,203,874 (GRCm39) V392E probably damaging Het
Fanca A G 8: 123,997,999 (GRCm39) V1229A probably benign Het
Fdps G T 3: 89,006,693 (GRCm39) Q66K probably benign Het
Fer1l6 T A 15: 58,499,438 (GRCm39) D1269E probably benign Het
Foxred1 G A 9: 35,116,932 (GRCm39) R353W probably damaging Het
Gabrg2 C T 11: 41,858,451 (GRCm39) V226I possibly damaging Het
Gcnt2 C A 13: 41,014,343 (GRCm39) C171* probably null Het
Glyat C A 19: 12,617,172 (GRCm39) A8E probably damaging Het
Golgb1 C A 16: 36,695,758 (GRCm39) R86S unknown Het
Hc T A 2: 34,940,431 (GRCm39) T136S probably damaging Het
Hdac1 G T 4: 129,411,259 (GRCm39) S421* probably null Het
Hmcn2 G T 2: 31,246,298 (GRCm39) A756S possibly damaging Het
Igkv8-26 A G 6: 70,170,571 (GRCm39) N54S probably benign Het
Itgae T A 11: 73,012,786 (GRCm39) V706E possibly damaging Het
Itgax G A 7: 127,747,262 (GRCm39) V992M probably damaging Het
Klk10 A G 7: 43,433,851 (GRCm39) D221G probably benign Het
Klkb1 T C 8: 45,731,150 (GRCm39) I205V probably benign Het
Kpna2 T C 11: 106,889,583 (GRCm39) N8S probably null Het
L3mbtl1 A C 2: 162,806,434 (GRCm39) T442P possibly damaging Het
Lrp1b C T 2: 40,551,561 (GRCm39) C4181Y Het
Mcat T C 15: 83,431,872 (GRCm39) Y332C probably damaging Het
Mecom T C 3: 30,010,534 (GRCm39) D648G probably damaging Het
Mesp2 A T 7: 79,460,717 (GRCm39) D14V probably damaging Het
Mlh3 A T 12: 85,314,973 (GRCm39) Y404* probably null Het
Mterf3 A T 13: 67,065,212 (GRCm39) F230I probably damaging Het
Nrxn3 T C 12: 89,478,832 (GRCm39) V602A probably benign Het
Or4a74 T A 2: 89,439,571 (GRCm39) I292F possibly damaging Het
Plekhg6 A G 6: 125,351,623 (GRCm39) F209L probably damaging Het
Pmp22 C A 11: 63,049,174 (GRCm39) A139D probably damaging Het
Polr2e T C 10: 79,874,404 (GRCm39) D34G possibly damaging Het
Ppard T A 17: 28,516,091 (GRCm39) L105H probably damaging Het
Ptpn14 T A 1: 189,582,942 (GRCm39) D596E probably benign Het
Ptprz1 C T 6: 23,002,518 (GRCm39) A1536V not run Het
Qng1 T A 13: 58,529,649 (GRCm39) H321L probably damaging Het
Rabgap1 TGGGG TGGG 2: 37,392,908 (GRCm39) probably null Het
Rmnd1 T C 10: 4,363,404 (GRCm39) K282R probably benign Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,229,111 (GRCm39) probably benign Het
Sall3 C T 18: 81,015,267 (GRCm39) R887H possibly damaging Het
Samd3 A G 10: 26,139,711 (GRCm39) D281G probably benign Het
Scube1 T A 15: 83,497,653 (GRCm39) D766V probably damaging Het
Sec24b TGC TGCAGC 3: 129,834,460 (GRCm39) probably benign Het
Slc2a2 A G 3: 28,752,166 (GRCm39) M1V probably null Het
Slc39a2 A T 14: 52,132,488 (GRCm39) T144S probably benign Het
Slc5a9 T C 4: 111,734,937 (GRCm39) H619R probably benign Het
Slco4a1 T C 2: 180,113,048 (GRCm39) F427L probably benign Het
Snapc3 C A 4: 83,336,073 (GRCm39) Y28* probably null Het
St3gal6 C T 16: 58,293,800 (GRCm39) R243H probably benign Het
Stat2 T A 10: 128,113,066 (GRCm39) N119K possibly damaging Het
Syne2 G C 12: 76,013,145 (GRCm39) V2779L probably benign Het
Tacc1 T A 8: 25,691,301 (GRCm39) M1L probably damaging Het
Tbc1d32 A T 10: 56,027,929 (GRCm39) F724L possibly damaging Het
Ttc23l A G 15: 10,533,766 (GRCm39) I259T possibly damaging Het
Ucn2 T C 9: 108,815,292 (GRCm39) I18T probably benign Het
Wdr35 G C 12: 9,074,886 (GRCm39) A1000P probably benign Het
Wnk1 C A 6: 119,906,789 (GRCm39) C244F possibly damaging Het
Zeb2 T G 2: 44,884,625 (GRCm39) D1022A probably damaging Het
Zfp26 A T 9: 20,349,129 (GRCm39) H478Q probably damaging Het
Zfp410 A G 12: 84,378,630 (GRCm39) K265R probably benign Het
Zfp575 T C 7: 24,286,093 (GRCm39) D21G probably benign Het
Other mutations in Retreg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02118:Retreg1 APN 15 25,966,709 (GRCm39) splice site probably null
IGL02548:Retreg1 APN 15 25,895,204 (GRCm39) nonsense probably null
R0834:Retreg1 UTSW 15 25,971,756 (GRCm39) missense probably benign 0.01
R1923:Retreg1 UTSW 15 25,969,924 (GRCm39) missense probably damaging 1.00
R1965:Retreg1 UTSW 15 25,970,250 (GRCm39) missense probably damaging 1.00
R4444:Retreg1 UTSW 15 25,968,530 (GRCm39) splice site probably null
R4529:Retreg1 UTSW 15 25,968,600 (GRCm39) missense probably damaging 1.00
R4778:Retreg1 UTSW 15 25,971,871 (GRCm39) missense possibly damaging 0.60
R5026:Retreg1 UTSW 15 25,970,214 (GRCm39) missense probably damaging 1.00
R5103:Retreg1 UTSW 15 25,968,540 (GRCm39) nonsense probably null
R6880:Retreg1 UTSW 15 25,971,825 (GRCm39) missense probably damaging 1.00
R7275:Retreg1 UTSW 15 25,971,684 (GRCm39) missense probably benign 0.44
R7357:Retreg1 UTSW 15 25,972,029 (GRCm39) missense probably damaging 0.97
R7488:Retreg1 UTSW 15 25,889,628 (GRCm39) missense
R7542:Retreg1 UTSW 15 25,941,296 (GRCm39) start codon destroyed probably null 0.10
R7670:Retreg1 UTSW 15 25,941,126 (GRCm39) intron probably benign
R8022:Retreg1 UTSW 15 25,843,565 (GRCm39) missense
R8084:Retreg1 UTSW 15 25,969,885 (GRCm39) missense probably benign 0.26
R8734:Retreg1 UTSW 15 25,968,493 (GRCm39) missense probably damaging 1.00
R9123:Retreg1 UTSW 15 25,968,618 (GRCm39) missense probably damaging 0.99
R9125:Retreg1 UTSW 15 25,968,618 (GRCm39) missense probably damaging 0.99
R9765:Retreg1 UTSW 15 25,940,985 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- GCAGGAGTCTATTACGTGGGATTC -3'
(R):5'- ATGGCGGCTGTGATGACATC -3'

Sequencing Primer
(F):5'- TCTTAGACCACTGCTCTGAGGG -3'
(R):5'- TGTGATGACATCCCCAGCCAG -3'
Posted On 2019-10-24