Incidental Mutation 'R7599:Fer1l6'
ID 587933
Institutional Source Beutler Lab
Gene Symbol Fer1l6
Ensembl Gene ENSMUSG00000037106
Gene Name fer-1 like family member 6
Synonyms EG631797
MMRRC Submission 045673-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.068) question?
Stock # R7599 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 58381897-58536936 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 58499438 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 1269 (D1269E)
Ref Sequence ENSEMBL: ENSMUSP00000125718 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000161028]
AlphaFold E0CZ42
Predicted Effect probably benign
Transcript: ENSMUST00000161028
AA Change: D1269E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000125718
Gene: ENSMUSG00000037106
AA Change: D1269E

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
C2 83 179 4.09e-12 SMART
FerI 165 235 2.06e-36 SMART
C2 243 354 5.19e-14 SMART
low complexity region 412 449 N/A INTRINSIC
FerB 714 787 2.53e-45 SMART
C2 829 936 8.84e-8 SMART
C2 1000 1099 3.05e0 SMART
low complexity region 1189 1203 N/A INTRINSIC
low complexity region 1256 1270 N/A INTRINSIC
C2 1361 1460 5.78e-12 SMART
low complexity region 1518 1529 N/A INTRINSIC
C2 1601 1731 1.01e-2 SMART
Pfam:Ferlin_C 1765 1857 2.3e-40 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts3 T C 5: 90,009,256 (GRCm39) S136G probably benign Het
Apba3 T A 10: 81,108,180 (GRCm39) N445K probably damaging Het
Aqp6 A G 15: 99,501,652 (GRCm39) K237E possibly damaging Het
Arhgap23 A G 11: 97,391,169 (GRCm39) T1229A probably benign Het
Bpifb1 T C 2: 154,056,071 (GRCm39) I379T probably damaging Het
Bpnt2 G A 4: 4,778,207 (GRCm39) T177I probably damaging Het
Ccdc169 A G 3: 55,047,530 (GRCm39) D7G probably damaging Het
Cyp2f2 T A 7: 26,830,784 (GRCm39) probably null Het
Daam2 T A 17: 49,787,755 (GRCm39) K453* probably null Het
Dennd4c T C 4: 86,729,849 (GRCm39) L817P probably damaging Het
Efcab6 T A 15: 83,755,189 (GRCm39) R1376W probably damaging Het
Esrra G T 19: 6,891,214 (GRCm39) A182E possibly damaging Het
Fam234b T A 6: 135,203,874 (GRCm39) V392E probably damaging Het
Fanca A G 8: 123,997,999 (GRCm39) V1229A probably benign Het
Fdps G T 3: 89,006,693 (GRCm39) Q66K probably benign Het
Foxred1 G A 9: 35,116,932 (GRCm39) R353W probably damaging Het
Gabrg2 C T 11: 41,858,451 (GRCm39) V226I possibly damaging Het
Gcnt2 C A 13: 41,014,343 (GRCm39) C171* probably null Het
Glyat C A 19: 12,617,172 (GRCm39) A8E probably damaging Het
Golgb1 C A 16: 36,695,758 (GRCm39) R86S unknown Het
Hc T A 2: 34,940,431 (GRCm39) T136S probably damaging Het
Hdac1 G T 4: 129,411,259 (GRCm39) S421* probably null Het
Hmcn2 G T 2: 31,246,298 (GRCm39) A756S possibly damaging Het
Igkv8-26 A G 6: 70,170,571 (GRCm39) N54S probably benign Het
Itgae T A 11: 73,012,786 (GRCm39) V706E possibly damaging Het
Itgax G A 7: 127,747,262 (GRCm39) V992M probably damaging Het
Klk10 A G 7: 43,433,851 (GRCm39) D221G probably benign Het
Klkb1 T C 8: 45,731,150 (GRCm39) I205V probably benign Het
Kpna2 T C 11: 106,889,583 (GRCm39) N8S probably null Het
L3mbtl1 A C 2: 162,806,434 (GRCm39) T442P possibly damaging Het
Lrp1b C T 2: 40,551,561 (GRCm39) C4181Y Het
Mcat T C 15: 83,431,872 (GRCm39) Y332C probably damaging Het
Mecom T C 3: 30,010,534 (GRCm39) D648G probably damaging Het
Mesp2 A T 7: 79,460,717 (GRCm39) D14V probably damaging Het
Mlh3 A T 12: 85,314,973 (GRCm39) Y404* probably null Het
Mterf3 A T 13: 67,065,212 (GRCm39) F230I probably damaging Het
Nrxn3 T C 12: 89,478,832 (GRCm39) V602A probably benign Het
Or4a74 T A 2: 89,439,571 (GRCm39) I292F possibly damaging Het
Plekhg6 A G 6: 125,351,623 (GRCm39) F209L probably damaging Het
Pmp22 C A 11: 63,049,174 (GRCm39) A139D probably damaging Het
Polr2e T C 10: 79,874,404 (GRCm39) D34G possibly damaging Het
Ppard T A 17: 28,516,091 (GRCm39) L105H probably damaging Het
Ptpn14 T A 1: 189,582,942 (GRCm39) D596E probably benign Het
Ptprz1 C T 6: 23,002,518 (GRCm39) A1536V not run Het
Qng1 T A 13: 58,529,649 (GRCm39) H321L probably damaging Het
Rabgap1 TGGGG TGGG 2: 37,392,908 (GRCm39) probably null Het
Retreg1 T A 15: 25,971,727 (GRCm39) D222E probably benign Het
Rmnd1 T C 10: 4,363,404 (GRCm39) K282R probably benign Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,229,111 (GRCm39) probably benign Het
Sall3 C T 18: 81,015,267 (GRCm39) R887H possibly damaging Het
Samd3 A G 10: 26,139,711 (GRCm39) D281G probably benign Het
Scube1 T A 15: 83,497,653 (GRCm39) D766V probably damaging Het
Sec24b TGC TGCAGC 3: 129,834,460 (GRCm39) probably benign Het
Slc2a2 A G 3: 28,752,166 (GRCm39) M1V probably null Het
Slc39a2 A T 14: 52,132,488 (GRCm39) T144S probably benign Het
Slc5a9 T C 4: 111,734,937 (GRCm39) H619R probably benign Het
Slco4a1 T C 2: 180,113,048 (GRCm39) F427L probably benign Het
Snapc3 C A 4: 83,336,073 (GRCm39) Y28* probably null Het
St3gal6 C T 16: 58,293,800 (GRCm39) R243H probably benign Het
Stat2 T A 10: 128,113,066 (GRCm39) N119K possibly damaging Het
Syne2 G C 12: 76,013,145 (GRCm39) V2779L probably benign Het
Tacc1 T A 8: 25,691,301 (GRCm39) M1L probably damaging Het
Tbc1d32 A T 10: 56,027,929 (GRCm39) F724L possibly damaging Het
Ttc23l A G 15: 10,533,766 (GRCm39) I259T possibly damaging Het
Ucn2 T C 9: 108,815,292 (GRCm39) I18T probably benign Het
Wdr35 G C 12: 9,074,886 (GRCm39) A1000P probably benign Het
Wnk1 C A 6: 119,906,789 (GRCm39) C244F possibly damaging Het
Zeb2 T G 2: 44,884,625 (GRCm39) D1022A probably damaging Het
Zfp26 A T 9: 20,349,129 (GRCm39) H478Q probably damaging Het
Zfp410 A G 12: 84,378,630 (GRCm39) K265R probably benign Het
Zfp575 T C 7: 24,286,093 (GRCm39) D21G probably benign Het
Other mutations in Fer1l6
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0009:Fer1l6 UTSW 15 58,534,636 (GRCm39) missense probably damaging 1.00
R0141:Fer1l6 UTSW 15 58,430,251 (GRCm39) missense probably damaging 1.00
R0178:Fer1l6 UTSW 15 58,509,763 (GRCm39) splice site probably null
R0304:Fer1l6 UTSW 15 58,462,411 (GRCm39) missense probably benign 0.08
R0379:Fer1l6 UTSW 15 58,420,187 (GRCm39) missense probably benign 0.05
R0457:Fer1l6 UTSW 15 58,509,943 (GRCm39) critical splice donor site probably null
R0546:Fer1l6 UTSW 15 58,430,257 (GRCm39) splice site probably null
R0602:Fer1l6 UTSW 15 58,449,794 (GRCm39) missense probably damaging 0.98
R0619:Fer1l6 UTSW 15 58,534,784 (GRCm39) splice site probably null
R0669:Fer1l6 UTSW 15 58,425,573 (GRCm39) splice site probably null
R0854:Fer1l6 UTSW 15 58,431,037 (GRCm39) missense probably benign 0.00
R0948:Fer1l6 UTSW 15 58,435,924 (GRCm39) missense probably benign 0.00
R1180:Fer1l6 UTSW 15 58,474,160 (GRCm39) splice site probably benign
R1483:Fer1l6 UTSW 15 58,509,819 (GRCm39) missense possibly damaging 0.84
R1627:Fer1l6 UTSW 15 58,513,728 (GRCm39) missense probably benign 0.41
R1635:Fer1l6 UTSW 15 58,518,930 (GRCm39) missense probably damaging 1.00
R1834:Fer1l6 UTSW 15 58,429,718 (GRCm39) missense possibly damaging 0.58
R1921:Fer1l6 UTSW 15 58,497,080 (GRCm39) missense probably damaging 1.00
R2000:Fer1l6 UTSW 15 58,474,160 (GRCm39) splice site probably benign
R2041:Fer1l6 UTSW 15 58,430,155 (GRCm39) missense probably damaging 1.00
R2144:Fer1l6 UTSW 15 58,499,383 (GRCm39) missense probably benign
R2145:Fer1l6 UTSW 15 58,499,383 (GRCm39) missense probably benign
R2981:Fer1l6 UTSW 15 58,435,926 (GRCm39) missense probably damaging 0.99
R4164:Fer1l6 UTSW 15 58,431,087 (GRCm39) missense possibly damaging 0.83
R4192:Fer1l6 UTSW 15 58,518,998 (GRCm39) missense probably damaging 1.00
R4273:Fer1l6 UTSW 15 58,499,371 (GRCm39) missense probably benign 0.41
R4573:Fer1l6 UTSW 15 58,498,129 (GRCm39) critical splice donor site probably null
R4581:Fer1l6 UTSW 15 58,512,075 (GRCm39) missense probably damaging 1.00
R4624:Fer1l6 UTSW 15 58,425,554 (GRCm39) missense probably damaging 1.00
R4755:Fer1l6 UTSW 15 58,512,060 (GRCm39) missense probably benign 0.09
R4774:Fer1l6 UTSW 15 58,449,798 (GRCm39) missense probably damaging 0.99
R4894:Fer1l6 UTSW 15 58,490,751 (GRCm39) missense probably damaging 1.00
R4896:Fer1l6 UTSW 15 58,509,869 (GRCm39) missense probably damaging 1.00
R4921:Fer1l6 UTSW 15 58,472,160 (GRCm39) critical splice acceptor site probably null
R4962:Fer1l6 UTSW 15 58,443,250 (GRCm39) missense probably benign 0.03
R5029:Fer1l6 UTSW 15 58,515,769 (GRCm39) missense probably benign 0.00
R5134:Fer1l6 UTSW 15 58,512,003 (GRCm39) missense probably damaging 1.00
R5175:Fer1l6 UTSW 15 58,422,126 (GRCm39) missense probably damaging 1.00
R5227:Fer1l6 UTSW 15 58,453,752 (GRCm39) nonsense probably null
R5561:Fer1l6 UTSW 15 58,532,674 (GRCm39) missense probably damaging 0.97
R5621:Fer1l6 UTSW 15 58,430,175 (GRCm39) missense probably damaging 1.00
R5670:Fer1l6 UTSW 15 58,494,331 (GRCm39) missense probably benign 0.00
R5745:Fer1l6 UTSW 15 58,443,238 (GRCm39) missense probably benign 0.01
R5807:Fer1l6 UTSW 15 58,462,399 (GRCm39) nonsense probably null
R5823:Fer1l6 UTSW 15 58,462,352 (GRCm39) nonsense probably null
R5892:Fer1l6 UTSW 15 58,435,917 (GRCm39) missense probably benign
R6006:Fer1l6 UTSW 15 58,518,893 (GRCm39) missense probably damaging 1.00
R6137:Fer1l6 UTSW 15 58,431,055 (GRCm39) missense probably damaging 0.97
R6195:Fer1l6 UTSW 15 58,509,806 (GRCm39) missense probably damaging 1.00
R6234:Fer1l6 UTSW 15 58,432,488 (GRCm39) missense probably damaging 1.00
R6237:Fer1l6 UTSW 15 58,509,855 (GRCm39) missense probably damaging 1.00
R6237:Fer1l6 UTSW 15 58,497,026 (GRCm39) nonsense probably null
R6271:Fer1l6 UTSW 15 58,513,767 (GRCm39) missense probably benign 0.01
R6336:Fer1l6 UTSW 15 58,431,081 (GRCm39) nonsense probably null
R6784:Fer1l6 UTSW 15 58,443,275 (GRCm39) missense possibly damaging 0.63
R6852:Fer1l6 UTSW 15 58,466,727 (GRCm39) missense probably damaging 1.00
R7030:Fer1l6 UTSW 15 58,501,227 (GRCm39) missense probably damaging 1.00
R7088:Fer1l6 UTSW 15 58,435,899 (GRCm39) missense possibly damaging 0.69
R7181:Fer1l6 UTSW 15 58,447,146 (GRCm39) missense probably benign 0.00
R7226:Fer1l6 UTSW 15 58,462,384 (GRCm39) missense probably benign 0.00
R7266:Fer1l6 UTSW 15 58,499,446 (GRCm39) missense probably benign
R7463:Fer1l6 UTSW 15 58,445,450 (GRCm39) nonsense probably null
R7464:Fer1l6 UTSW 15 58,445,096 (GRCm39) splice site probably null
R7469:Fer1l6 UTSW 15 58,462,419 (GRCm39) splice site probably null
R7483:Fer1l6 UTSW 15 58,513,794 (GRCm39) missense possibly damaging 0.83
R7491:Fer1l6 UTSW 15 58,472,281 (GRCm39) missense probably damaging 1.00
R7534:Fer1l6 UTSW 15 58,509,875 (GRCm39) missense probably damaging 1.00
R7562:Fer1l6 UTSW 15 58,432,331 (GRCm39) missense probably benign 0.00
R7580:Fer1l6 UTSW 15 58,430,245 (GRCm39) missense probably benign 0.41
R7607:Fer1l6 UTSW 15 58,534,581 (GRCm39) nonsense probably null
R7677:Fer1l6 UTSW 15 58,474,139 (GRCm39) missense probably benign 0.00
R8202:Fer1l6 UTSW 15 58,502,486 (GRCm39) missense probably damaging 1.00
R8261:Fer1l6 UTSW 15 58,432,345 (GRCm39) missense possibly damaging 0.84
R8847:Fer1l6 UTSW 15 58,414,012 (GRCm39) missense possibly damaging 0.72
R9022:Fer1l6 UTSW 15 58,455,329 (GRCm39) missense probably damaging 0.99
R9030:Fer1l6 UTSW 15 58,502,594 (GRCm39) missense probably damaging 1.00
R9160:Fer1l6 UTSW 15 58,515,715 (GRCm39) missense possibly damaging 0.94
R9180:Fer1l6 UTSW 15 58,494,230 (GRCm39) missense probably benign 0.19
R9289:Fer1l6 UTSW 15 58,490,766 (GRCm39) missense probably damaging 1.00
R9559:Fer1l6 UTSW 15 58,429,759 (GRCm39) missense possibly damaging 0.88
R9562:Fer1l6 UTSW 15 58,490,370 (GRCm39) missense possibly damaging 0.70
R9682:Fer1l6 UTSW 15 58,422,113 (GRCm39) missense probably benign 0.03
R9775:Fer1l6 UTSW 15 58,497,098 (GRCm39) missense probably benign
X0021:Fer1l6 UTSW 15 58,441,051 (GRCm39) nonsense probably null
X0027:Fer1l6 UTSW 15 58,501,189 (GRCm39) missense probably damaging 1.00
X0063:Fer1l6 UTSW 15 58,490,423 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGGGCAGCCACAGACATTG -3'
(R):5'- CAGGCAGGCTTCATTGTCTTG -3'

Sequencing Primer
(F):5'- GCCACAGACATTGCACTTACATATG -3'
(R):5'- CATGTTATTTTCCCATGTGAGTGAC -3'
Posted On 2019-10-24