Incidental Mutation 'R7599:Mcat'
ID 587934
Institutional Source Beutler Lab
Gene Symbol Mcat
Ensembl Gene ENSMUSG00000048755
Gene Name malonyl CoA:ACP acyltransferase (mitochondrial)
Synonyms
MMRRC Submission 045673-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.493) question?
Stock # R7599 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 83430998-83439936 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 83431872 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 332 (Y332C)
Ref Sequence ENSEMBL: ENSMUSP00000051569 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016902] [ENSMUST00000061882] [ENSMUST00000229165] [ENSMUST00000229724] [ENSMUST00000229964] [ENSMUST00000230912]
AlphaFold Q8R3F5
Predicted Effect probably benign
Transcript: ENSMUST00000016902
SMART Domains Protein: ENSMUSP00000016902
Gene: ENSMUSG00000016758

DomainStartEndE-ValueType
Pfam:bcl-2I13 1 149 1.5e-72 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000061882
AA Change: Y332C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000051569
Gene: ENSMUSG00000048755
AA Change: Y332C

DomainStartEndE-ValueType
low complexity region 2 24 N/A INTRINSIC
Pfam:Acyl_transf_1 62 342 5.8e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000229165
Predicted Effect probably benign
Transcript: ENSMUST00000229724
Predicted Effect probably benign
Transcript: ENSMUST00000229964
Predicted Effect probably benign
Transcript: ENSMUST00000230851
Predicted Effect probably benign
Transcript: ENSMUST00000230912
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is found exclusively in the mitochondrion, where it catalyzes the transfer of a malonyl group from malonyl-CoA to the mitochondrial acyl carrier protein. The encoded protein may be part of a fatty acid synthase complex that is more like the type II prokaryotic and plastid complexes rather than the type I human cytosolic complex. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice homozygous for a conditional allele activated ubiquitously consume more food, fail to gain weight, are less physically active, and suffer from loss of white adipose tissue, reduced muscle strength, kyphosis, alopecia, hypothermia and shortened lifespan. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts3 T C 5: 90,009,256 (GRCm39) S136G probably benign Het
Apba3 T A 10: 81,108,180 (GRCm39) N445K probably damaging Het
Aqp6 A G 15: 99,501,652 (GRCm39) K237E possibly damaging Het
Arhgap23 A G 11: 97,391,169 (GRCm39) T1229A probably benign Het
Bpifb1 T C 2: 154,056,071 (GRCm39) I379T probably damaging Het
Bpnt2 G A 4: 4,778,207 (GRCm39) T177I probably damaging Het
Ccdc169 A G 3: 55,047,530 (GRCm39) D7G probably damaging Het
Cyp2f2 T A 7: 26,830,784 (GRCm39) probably null Het
Daam2 T A 17: 49,787,755 (GRCm39) K453* probably null Het
Dennd4c T C 4: 86,729,849 (GRCm39) L817P probably damaging Het
Efcab6 T A 15: 83,755,189 (GRCm39) R1376W probably damaging Het
Esrra G T 19: 6,891,214 (GRCm39) A182E possibly damaging Het
Fam234b T A 6: 135,203,874 (GRCm39) V392E probably damaging Het
Fanca A G 8: 123,997,999 (GRCm39) V1229A probably benign Het
Fdps G T 3: 89,006,693 (GRCm39) Q66K probably benign Het
Fer1l6 T A 15: 58,499,438 (GRCm39) D1269E probably benign Het
Foxred1 G A 9: 35,116,932 (GRCm39) R353W probably damaging Het
Gabrg2 C T 11: 41,858,451 (GRCm39) V226I possibly damaging Het
Gcnt2 C A 13: 41,014,343 (GRCm39) C171* probably null Het
Glyat C A 19: 12,617,172 (GRCm39) A8E probably damaging Het
Golgb1 C A 16: 36,695,758 (GRCm39) R86S unknown Het
Hc T A 2: 34,940,431 (GRCm39) T136S probably damaging Het
Hdac1 G T 4: 129,411,259 (GRCm39) S421* probably null Het
Hmcn2 G T 2: 31,246,298 (GRCm39) A756S possibly damaging Het
Igkv8-26 A G 6: 70,170,571 (GRCm39) N54S probably benign Het
Itgae T A 11: 73,012,786 (GRCm39) V706E possibly damaging Het
Itgax G A 7: 127,747,262 (GRCm39) V992M probably damaging Het
Klk10 A G 7: 43,433,851 (GRCm39) D221G probably benign Het
Klkb1 T C 8: 45,731,150 (GRCm39) I205V probably benign Het
Kpna2 T C 11: 106,889,583 (GRCm39) N8S probably null Het
L3mbtl1 A C 2: 162,806,434 (GRCm39) T442P possibly damaging Het
Lrp1b C T 2: 40,551,561 (GRCm39) C4181Y Het
Mecom T C 3: 30,010,534 (GRCm39) D648G probably damaging Het
Mesp2 A T 7: 79,460,717 (GRCm39) D14V probably damaging Het
Mlh3 A T 12: 85,314,973 (GRCm39) Y404* probably null Het
Mterf3 A T 13: 67,065,212 (GRCm39) F230I probably damaging Het
Nrxn3 T C 12: 89,478,832 (GRCm39) V602A probably benign Het
Or4a74 T A 2: 89,439,571 (GRCm39) I292F possibly damaging Het
Plekhg6 A G 6: 125,351,623 (GRCm39) F209L probably damaging Het
Pmp22 C A 11: 63,049,174 (GRCm39) A139D probably damaging Het
Polr2e T C 10: 79,874,404 (GRCm39) D34G possibly damaging Het
Ppard T A 17: 28,516,091 (GRCm39) L105H probably damaging Het
Ptpn14 T A 1: 189,582,942 (GRCm39) D596E probably benign Het
Ptprz1 C T 6: 23,002,518 (GRCm39) A1536V not run Het
Qng1 T A 13: 58,529,649 (GRCm39) H321L probably damaging Het
Rabgap1 TGGGG TGGG 2: 37,392,908 (GRCm39) probably null Het
Retreg1 T A 15: 25,971,727 (GRCm39) D222E probably benign Het
Rmnd1 T C 10: 4,363,404 (GRCm39) K282R probably benign Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,229,111 (GRCm39) probably benign Het
Sall3 C T 18: 81,015,267 (GRCm39) R887H possibly damaging Het
Samd3 A G 10: 26,139,711 (GRCm39) D281G probably benign Het
Scube1 T A 15: 83,497,653 (GRCm39) D766V probably damaging Het
Sec24b TGC TGCAGC 3: 129,834,460 (GRCm39) probably benign Het
Slc2a2 A G 3: 28,752,166 (GRCm39) M1V probably null Het
Slc39a2 A T 14: 52,132,488 (GRCm39) T144S probably benign Het
Slc5a9 T C 4: 111,734,937 (GRCm39) H619R probably benign Het
Slco4a1 T C 2: 180,113,048 (GRCm39) F427L probably benign Het
Snapc3 C A 4: 83,336,073 (GRCm39) Y28* probably null Het
St3gal6 C T 16: 58,293,800 (GRCm39) R243H probably benign Het
Stat2 T A 10: 128,113,066 (GRCm39) N119K possibly damaging Het
Syne2 G C 12: 76,013,145 (GRCm39) V2779L probably benign Het
Tacc1 T A 8: 25,691,301 (GRCm39) M1L probably damaging Het
Tbc1d32 A T 10: 56,027,929 (GRCm39) F724L possibly damaging Het
Ttc23l A G 15: 10,533,766 (GRCm39) I259T possibly damaging Het
Ucn2 T C 9: 108,815,292 (GRCm39) I18T probably benign Het
Wdr35 G C 12: 9,074,886 (GRCm39) A1000P probably benign Het
Wnk1 C A 6: 119,906,789 (GRCm39) C244F possibly damaging Het
Zeb2 T G 2: 44,884,625 (GRCm39) D1022A probably damaging Het
Zfp26 A T 9: 20,349,129 (GRCm39) H478Q probably damaging Het
Zfp410 A G 12: 84,378,630 (GRCm39) K265R probably benign Het
Zfp575 T C 7: 24,286,093 (GRCm39) D21G probably benign Het
Other mutations in Mcat
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0569:Mcat UTSW 15 83,433,449 (GRCm39) missense probably benign 0.00
R1497:Mcat UTSW 15 83,433,453 (GRCm39) nonsense probably null
R5518:Mcat UTSW 15 83,431,875 (GRCm39) splice site probably null
R5909:Mcat UTSW 15 83,432,116 (GRCm39) missense probably benign 0.20
R6508:Mcat UTSW 15 83,433,452 (GRCm39) missense probably benign
R6582:Mcat UTSW 15 83,433,383 (GRCm39) missense probably benign 0.00
R6964:Mcat UTSW 15 83,432,132 (GRCm39) unclassified probably benign
R7814:Mcat UTSW 15 83,432,110 (GRCm39) missense probably damaging 0.97
R8306:Mcat UTSW 15 83,439,592 (GRCm39) missense probably damaging 0.99
R8825:Mcat UTSW 15 83,436,812 (GRCm39) missense probably benign 0.00
R9064:Mcat UTSW 15 83,432,134 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCACACTGGGGCCATTCTAAG -3'
(R):5'- GATGCTGCCTGTAAGTGGAG -3'

Sequencing Primer
(F):5'- GGCCATTCTAAGCCCAAGG -3'
(R):5'- ATACCTGCCTCATGGAGCCAG -3'
Posted On 2019-10-24