Mutagenetix > Incidental Mutation

Incidental Mutation 'R7599:Mcat'

587934

Institutional Source

Beutler Lab

Gene Symbol

Mcat

Ensembl Gene

ENSMUSG00000048755

Gene Name

malonyl CoA:ACP acyltransferase (mitochondrial)

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.474) question?

Stock #

R7599 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

83546797-83563787 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 83547671 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 332 (Y332C)

Ref Sequence

ENSEMBL: ENSMUSP00000051569 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000016902] [ENSMUST00000061882] [ENSMUST00000229165] [ENSMUST00000229724] [ENSMUST00000229964] [ENSMUST00000230912]

AlphaFold

Q8R3F5

Predicted Effect

probably benign
Transcript: ENSMUST00000016902

SMART Domains

Protein: ENSMUSP00000016902
Gene: ENSMUSG00000016758

Domain	Start	End	E-Value	Type
Pfam:bcl-2I13	1	149	1.5e-72	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000061882
AA Change: Y332C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000051569
Gene: ENSMUSG00000048755
AA Change: Y332C

Domain	Start	End	E-Value	Type
low complexity region	2	24	N/A	INTRINSIC
Pfam:Acyl_transf_1	62	342	5.8e-25	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000229165

Predicted Effect

probably benign
Transcript: ENSMUST00000229724

Predicted Effect

probably benign
Transcript: ENSMUST00000229964

Predicted Effect

probably benign
Transcript: ENSMUST00000230851

Predicted Effect

probably benign
Transcript: ENSMUST00000230912

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is found exclusively in the mitochondrion, where it catalyzes the transfer of a malonyl group from malonyl-CoA to the mitochondrial acyl carrier protein. The encoded protein may be part of a fatty acid synthase complex that is more like the type II prokaryotic and plastid complexes rather than the type I human cytosolic complex. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice homozygous for a conditional allele activated ubiquitously consume more food, fail to gain weight, are less physically active, and suffer from loss of white adipose tissue, reduced muscle strength, kyphosis, alopecia, hypothermia and shortened lifespan. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2210016F16Rik	T	A	13: 58,381,835	H321L	probably damaging	Het
Adamts3	T	C	5: 89,861,397	S136G	probably benign	Het
Apba3	T	A	10: 81,272,346	N445K	probably damaging	Het
Aqp6	A	G	15: 99,603,771	K237E	possibly damaging	Het
Arhgap23	A	G	11: 97,500,343	T1229A	probably benign	Het
Bpifb1	T	C	2: 154,214,151	I379T	probably damaging	Het
Ccdc169	A	G	3: 55,140,109	D7G	probably damaging	Het
Cyp2f2	T	A	7: 27,131,359		probably null	Het
Daam2	T	A	17: 49,480,727	K453*	probably null	Het
Dennd4c	T	C	4: 86,811,612	L817P	probably damaging	Het
Efcab6	T	A	15: 83,870,988	R1376W	probably damaging	Het
Esrra	G	T	19: 6,913,846	A182E	possibly damaging	Het
Fam234b	T	A	6: 135,226,876	V392E	probably damaging	Het
Fanca	A	G	8: 123,271,260	V1229A	probably benign	Het
Fdps	G	T	3: 89,099,386	Q66K	probably benign	Het
Fer1l6	T	A	15: 58,627,589	D1269E	probably benign	Het
Foxred1	G	A	9: 35,205,636	R353W	probably damaging	Het
Gabrg2	C	T	11: 41,967,624	V226I	possibly damaging	Het
Gcnt2	C	A	13: 40,860,867	C171*	probably null	Het
Glyat	C	A	19: 12,639,808	A8E	probably damaging	Het
Golgb1	C	A	16: 36,875,396	R86S	unknown	Het
Hc	T	A	2: 35,050,419	T136S	probably damaging	Het
Hdac1	G	T	4: 129,517,466	S421*	probably null	Het
Hmcn2	G	T	2: 31,356,286	A756S	possibly damaging	Het
Igkv8-26	A	G	6: 70,193,587	N54S	probably benign	Het
Impad1	G	A	4: 4,778,207	T177I	probably damaging	Het
Itgae	T	A	11: 73,121,960	V706E	possibly damaging	Het
Itgax	G	A	7: 128,148,090	V992M	probably damaging	Het
Klk10	A	G	7: 43,784,427	D221G	probably benign	Het
Klkb1	T	C	8: 45,278,113	I205V	probably benign	Het
Kpna2	T	C	11: 106,998,757	N8S	probably null	Het
L3mbtl1	A	C	2: 162,964,514	T442P	possibly damaging	Het
Lrp1b	C	T	2: 40,661,549	C4181Y		Het
Mecom	T	C	3: 29,956,385	D648G	probably damaging	Het
Mesp2	A	T	7: 79,810,969	D14V	probably damaging	Het
Mlh3	A	T	12: 85,268,199	Y404*	probably null	Het
Mterf3	A	T	13: 66,917,148	F230I	probably damaging	Het
Nrxn3	T	C	12: 89,512,062	V602A	probably benign	Het
Olfr1247	T	A	2: 89,609,227	I292F	possibly damaging	Het
Plekhg6	A	G	6: 125,374,660	F209L	probably damaging	Het
Pmp22	C	A	11: 63,158,348	A139D	probably damaging	Het
Polr2e	T	C	10: 80,038,570	D34G	possibly damaging	Het
Ppard	T	A	17: 28,297,117	L105H	probably damaging	Het
Ptpn14	T	A	1: 189,850,745	D596E	probably benign	Het
Ptprz1	C	T	6: 23,002,519	A1536V	not run	Het
Rabgap1	TGGGG	TGGG	2: 37,502,896		probably null	Het
Retreg1	T	A	15: 25,971,641	D222E	probably benign	Het
Rmnd1	T	C	10: 4,413,404	K282R	probably benign	Het
Rsf1	ATGGCG	ATGGCGACGGTGGCG	7: 97,579,904		probably benign	Het
Sall3	C	T	18: 80,972,052	R887H	possibly damaging	Het
Samd3	A	G	10: 26,263,813	D281G	probably benign	Het
Scube1	T	A	15: 83,613,452	D766V	probably damaging	Het
Sec24b	TGC	TGCAGC	3: 130,040,811		probably benign	Het
Slc2a2	A	G	3: 28,698,017	M1V	probably null	Het
Slc39a2	A	T	14: 51,895,031	T144S	probably benign	Het
Slc5a9	T	C	4: 111,877,740	H619R	probably benign	Het
Slco4a1	T	C	2: 180,471,255	F427L	probably benign	Het
Snapc3	C	A	4: 83,417,836	Y28*	probably null	Het
St3gal6	C	T	16: 58,473,437	R243H	probably benign	Het
Stat2	T	A	10: 128,277,197	N119K	possibly damaging	Het
Syne2	G	C	12: 75,966,371	V2779L	probably benign	Het
Tacc1	T	A	8: 25,201,285	M1L	probably damaging	Het
Tbc1d32	A	T	10: 56,151,833	F724L	possibly damaging	Het
Ttc23l	A	G	15: 10,533,680	I259T	possibly damaging	Het
Ucn2	T	C	9: 108,986,224	I18T	probably benign	Het
Wdr35	G	C	12: 9,024,886	A1000P	probably benign	Het
Wnk1	C	A	6: 119,929,828	C244F	possibly damaging	Het
Zeb2	T	G	2: 44,994,613	D1022A	probably damaging	Het
Zfp26	A	T	9: 20,437,833	H478Q	probably damaging	Het
Zfp410	A	G	12: 84,331,856	K265R	probably benign	Het
Zfp575	T	C	7: 24,586,668	D21G	probably benign	Het

Other mutations in Mcat

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
R0569:Mcat	UTSW	15	83549248	missense	probably benign	0.00
R1497:Mcat	UTSW	15	83549252	nonsense	probably null
R5518:Mcat	UTSW	15	83547674	splice site	probably null
R5909:Mcat	UTSW	15	83547915	missense	probably benign	0.20
R6508:Mcat	UTSW	15	83549251	missense	probably benign
R6582:Mcat	UTSW	15	83549182	missense	probably benign	0.00
R6964:Mcat	UTSW	15	83547931	unclassified	probably benign
R7814:Mcat	UTSW	15	83547909	missense	probably damaging	0.97
R8306:Mcat	UTSW	15	83555391	missense	probably damaging	0.99
R8825:Mcat	UTSW	15	83552611	missense	probably benign	0.00
R9064:Mcat	UTSW	15	83547933	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTCACACTGGGGCCATTCTAAG -3'
(R):5'- GATGCTGCCTGTAAGTGGAG -3'

Sequencing Primer
(F):5'- GGCCATTCTAAGCCCAAGG -3'
(R):5'- ATACCTGCCTCATGGAGCCAG -3'

Posted On

2019-10-24