Incidental Mutation 'R7599:Scube1'
ID 587935
Institutional Source Beutler Lab
Gene Symbol Scube1
Ensembl Gene ENSMUSG00000016763
Gene Name signal peptide, CUB domain, EGF-like 1
Synonyms 7330410C13Rik, A630023E24Rik
MMRRC Submission 045673-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.135) question?
Stock # R7599 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 83489200-83609222 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 83497653 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 766 (D766V)
Ref Sequence ENSEMBL: ENSMUSP00000016907 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016907] [ENSMUST00000043634] [ENSMUST00000076060] [ENSMUST00000171496]
AlphaFold Q6NZL8
Predicted Effect probably damaging
Transcript: ENSMUST00000016907
AA Change: D766V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000016907
Gene: ENSMUSG00000016763
AA Change: D766V

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
EGF_CA 33 73 1.5e-9 SMART
EGF_CA 74 116 7.29e-8 SMART
EGF_CA 117 157 1.4e-9 SMART
EGF 165 203 1.43e-1 SMART
EGF 205 242 1.09e1 SMART
EGF 274 311 1.69e-3 SMART
EGF_CA 312 352 2.13e-9 SMART
EGF_CA 353 391 4.7e-11 SMART
EGF_CA 392 432 3.91e-8 SMART
low complexity region 560 573 N/A INTRINSIC
Pfam:GCC2_GCC3 666 713 4.5e-13 PFAM
EGF_like 766 804 6.81e1 SMART
CUB 828 940 1.51e-19 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000043634
AA Change: D655V

PolyPhen 2 Score 0.847 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000044835
Gene: ENSMUSG00000016763
AA Change: D655V

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
EGF_CA 33 73 1.5e-9 SMART
EGF_CA 74 116 7.29e-8 SMART
EGF_CA 117 157 1.4e-9 SMART
EGF 163 200 1.69e-3 SMART
EGF_CA 201 241 2.13e-9 SMART
EGF_CA 242 280 4.7e-11 SMART
EGF_CA 281 321 3.91e-8 SMART
low complexity region 449 462 N/A INTRINSIC
Pfam:GCC2_GCC3 555 602 3.2e-11 PFAM
EGF_like 655 693 6.81e1 SMART
CUB 717 829 1.51e-19 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000076060
AA Change: D736V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000075434
Gene: ENSMUSG00000016763
AA Change: D736V

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
EGF_CA 33 73 1.5e-9 SMART
EGF_CA 74 116 7.29e-8 SMART
EGF_CA 117 157 1.4e-9 SMART
EGF 165 203 1.43e-1 SMART
EGF 205 242 1.09e1 SMART
EGF 244 281 1.69e-3 SMART
EGF_CA 282 322 2.13e-9 SMART
EGF_CA 323 361 4.7e-11 SMART
EGF_CA 362 402 3.91e-8 SMART
low complexity region 530 543 N/A INTRINSIC
Pfam:GCC2_GCC3 636 683 1.3e-11 PFAM
EGF_like 736 774 6.81e1 SMART
CUB 798 910 1.51e-19 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000171496
AA Change: D736V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130131
Gene: ENSMUSG00000016763
AA Change: D736V

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
EGF_CA 33 73 1.5e-9 SMART
EGF_CA 74 116 7.29e-8 SMART
EGF_CA 117 157 1.4e-9 SMART
EGF 165 203 1.43e-1 SMART
EGF 205 242 1.09e1 SMART
EGF 244 281 1.69e-3 SMART
EGF_CA 282 322 2.13e-9 SMART
EGF_CA 323 361 4.7e-11 SMART
EGF_CA 362 402 3.91e-8 SMART
low complexity region 530 543 N/A INTRINSIC
Pfam:GCC2_GCC3 636 683 1.7e-11 PFAM
EGF_like 736 774 6.81e1 SMART
CUB 798 910 1.51e-19 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cell surface glycoprotein that is a member of the SCUBE (signal peptide, CUB domain, EGF (epidermal growth factor)-like protein) family. Family members have an amino-terminal signal peptide, nine copies of EGF-like repeats and a CUB domain at the carboxyl terminus. This protein is expressed in platelets and endothelial cells and may play an important role in vascular biology. [provided by RefSeq, Oct 2011]
PHENOTYPE: A fraction of homozygotes die neonatally with acrania and loss of brain tissue. Early skull bone defects include lack of the interparietal and supraoccipital bones and cranial vault. Affected mutant embryos show exencephaly, a thick-walled forebrain neuroepithelium and hyperplastic cranial ganglia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts3 T C 5: 90,009,256 (GRCm39) S136G probably benign Het
Apba3 T A 10: 81,108,180 (GRCm39) N445K probably damaging Het
Aqp6 A G 15: 99,501,652 (GRCm39) K237E possibly damaging Het
Arhgap23 A G 11: 97,391,169 (GRCm39) T1229A probably benign Het
Bpifb1 T C 2: 154,056,071 (GRCm39) I379T probably damaging Het
Bpnt2 G A 4: 4,778,207 (GRCm39) T177I probably damaging Het
Ccdc169 A G 3: 55,047,530 (GRCm39) D7G probably damaging Het
Cyp2f2 T A 7: 26,830,784 (GRCm39) probably null Het
Daam2 T A 17: 49,787,755 (GRCm39) K453* probably null Het
Dennd4c T C 4: 86,729,849 (GRCm39) L817P probably damaging Het
Efcab6 T A 15: 83,755,189 (GRCm39) R1376W probably damaging Het
Esrra G T 19: 6,891,214 (GRCm39) A182E possibly damaging Het
Fam234b T A 6: 135,203,874 (GRCm39) V392E probably damaging Het
Fanca A G 8: 123,997,999 (GRCm39) V1229A probably benign Het
Fdps G T 3: 89,006,693 (GRCm39) Q66K probably benign Het
Fer1l6 T A 15: 58,499,438 (GRCm39) D1269E probably benign Het
Foxred1 G A 9: 35,116,932 (GRCm39) R353W probably damaging Het
Gabrg2 C T 11: 41,858,451 (GRCm39) V226I possibly damaging Het
Gcnt2 C A 13: 41,014,343 (GRCm39) C171* probably null Het
Glyat C A 19: 12,617,172 (GRCm39) A8E probably damaging Het
Golgb1 C A 16: 36,695,758 (GRCm39) R86S unknown Het
Hc T A 2: 34,940,431 (GRCm39) T136S probably damaging Het
Hdac1 G T 4: 129,411,259 (GRCm39) S421* probably null Het
Hmcn2 G T 2: 31,246,298 (GRCm39) A756S possibly damaging Het
Igkv8-26 A G 6: 70,170,571 (GRCm39) N54S probably benign Het
Itgae T A 11: 73,012,786 (GRCm39) V706E possibly damaging Het
Itgax G A 7: 127,747,262 (GRCm39) V992M probably damaging Het
Klk10 A G 7: 43,433,851 (GRCm39) D221G probably benign Het
Klkb1 T C 8: 45,731,150 (GRCm39) I205V probably benign Het
Kpna2 T C 11: 106,889,583 (GRCm39) N8S probably null Het
L3mbtl1 A C 2: 162,806,434 (GRCm39) T442P possibly damaging Het
Lrp1b C T 2: 40,551,561 (GRCm39) C4181Y Het
Mcat T C 15: 83,431,872 (GRCm39) Y332C probably damaging Het
Mecom T C 3: 30,010,534 (GRCm39) D648G probably damaging Het
Mesp2 A T 7: 79,460,717 (GRCm39) D14V probably damaging Het
Mlh3 A T 12: 85,314,973 (GRCm39) Y404* probably null Het
Mterf3 A T 13: 67,065,212 (GRCm39) F230I probably damaging Het
Nrxn3 T C 12: 89,478,832 (GRCm39) V602A probably benign Het
Or4a74 T A 2: 89,439,571 (GRCm39) I292F possibly damaging Het
Plekhg6 A G 6: 125,351,623 (GRCm39) F209L probably damaging Het
Pmp22 C A 11: 63,049,174 (GRCm39) A139D probably damaging Het
Polr2e T C 10: 79,874,404 (GRCm39) D34G possibly damaging Het
Ppard T A 17: 28,516,091 (GRCm39) L105H probably damaging Het
Ptpn14 T A 1: 189,582,942 (GRCm39) D596E probably benign Het
Ptprz1 C T 6: 23,002,518 (GRCm39) A1536V not run Het
Qng1 T A 13: 58,529,649 (GRCm39) H321L probably damaging Het
Rabgap1 TGGGG TGGG 2: 37,392,908 (GRCm39) probably null Het
Retreg1 T A 15: 25,971,727 (GRCm39) D222E probably benign Het
Rmnd1 T C 10: 4,363,404 (GRCm39) K282R probably benign Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,229,111 (GRCm39) probably benign Het
Sall3 C T 18: 81,015,267 (GRCm39) R887H possibly damaging Het
Samd3 A G 10: 26,139,711 (GRCm39) D281G probably benign Het
Sec24b TGC TGCAGC 3: 129,834,460 (GRCm39) probably benign Het
Slc2a2 A G 3: 28,752,166 (GRCm39) M1V probably null Het
Slc39a2 A T 14: 52,132,488 (GRCm39) T144S probably benign Het
Slc5a9 T C 4: 111,734,937 (GRCm39) H619R probably benign Het
Slco4a1 T C 2: 180,113,048 (GRCm39) F427L probably benign Het
Snapc3 C A 4: 83,336,073 (GRCm39) Y28* probably null Het
St3gal6 C T 16: 58,293,800 (GRCm39) R243H probably benign Het
Stat2 T A 10: 128,113,066 (GRCm39) N119K possibly damaging Het
Syne2 G C 12: 76,013,145 (GRCm39) V2779L probably benign Het
Tacc1 T A 8: 25,691,301 (GRCm39) M1L probably damaging Het
Tbc1d32 A T 10: 56,027,929 (GRCm39) F724L possibly damaging Het
Ttc23l A G 15: 10,533,766 (GRCm39) I259T possibly damaging Het
Ucn2 T C 9: 108,815,292 (GRCm39) I18T probably benign Het
Wdr35 G C 12: 9,074,886 (GRCm39) A1000P probably benign Het
Wnk1 C A 6: 119,906,789 (GRCm39) C244F possibly damaging Het
Zeb2 T G 2: 44,884,625 (GRCm39) D1022A probably damaging Het
Zfp26 A T 9: 20,349,129 (GRCm39) H478Q probably damaging Het
Zfp410 A G 12: 84,378,630 (GRCm39) K265R probably benign Het
Zfp575 T C 7: 24,286,093 (GRCm39) D21G probably benign Het
Other mutations in Scube1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00903:Scube1 APN 15 83,587,702 (GRCm39) missense probably damaging 0.98
IGL01152:Scube1 APN 15 83,497,771 (GRCm39) missense probably damaging 1.00
IGL01388:Scube1 APN 15 83,504,332 (GRCm39) missense probably benign 0.00
IGL01589:Scube1 APN 15 83,496,754 (GRCm39) missense probably damaging 1.00
IGL02208:Scube1 APN 15 83,587,741 (GRCm39) missense probably damaging 1.00
IGL02305:Scube1 APN 15 83,491,591 (GRCm39) missense probably damaging 1.00
IGL02728:Scube1 APN 15 83,543,217 (GRCm39) splice site probably benign
IGL02737:Scube1 APN 15 83,606,044 (GRCm39) splice site probably benign
IGL03326:Scube1 APN 15 83,491,617 (GRCm39) missense probably damaging 1.00
R0055:Scube1 UTSW 15 83,518,937 (GRCm39) missense probably damaging 1.00
R0055:Scube1 UTSW 15 83,518,937 (GRCm39) missense probably damaging 1.00
R0126:Scube1 UTSW 15 83,505,264 (GRCm39) missense probably damaging 1.00
R0792:Scube1 UTSW 15 83,512,277 (GRCm39) critical splice acceptor site probably null
R1438:Scube1 UTSW 15 83,499,227 (GRCm39) missense possibly damaging 0.93
R1522:Scube1 UTSW 15 83,512,277 (GRCm39) critical splice acceptor site probably null
R1735:Scube1 UTSW 15 83,491,638 (GRCm39) missense probably damaging 1.00
R1766:Scube1 UTSW 15 83,606,146 (GRCm39) missense probably damaging 1.00
R1778:Scube1 UTSW 15 83,494,405 (GRCm39) missense probably damaging 1.00
R2975:Scube1 UTSW 15 83,543,299 (GRCm39) missense probably damaging 0.99
R4080:Scube1 UTSW 15 83,492,948 (GRCm39) missense probably damaging 1.00
R4434:Scube1 UTSW 15 83,606,125 (GRCm39) missense probably damaging 1.00
R5585:Scube1 UTSW 15 83,561,124 (GRCm39) missense probably damaging 1.00
R5857:Scube1 UTSW 15 83,491,461 (GRCm39) unclassified probably benign
R5977:Scube1 UTSW 15 83,513,689 (GRCm39) missense probably damaging 1.00
R6054:Scube1 UTSW 15 83,535,877 (GRCm39) missense probably benign 0.43
R6461:Scube1 UTSW 15 83,496,628 (GRCm39) missense probably damaging 1.00
R6956:Scube1 UTSW 15 83,606,077 (GRCm39) missense probably damaging 1.00
R6959:Scube1 UTSW 15 83,513,636 (GRCm39) missense probably benign 0.42
R7124:Scube1 UTSW 15 83,513,712 (GRCm39) splice site probably null
R7267:Scube1 UTSW 15 83,505,266 (GRCm39) missense probably damaging 1.00
R7404:Scube1 UTSW 15 83,499,211 (GRCm39) missense probably damaging 0.98
R7584:Scube1 UTSW 15 83,606,088 (GRCm39) nonsense probably null
R7585:Scube1 UTSW 15 83,522,988 (GRCm39) missense possibly damaging 0.83
R8055:Scube1 UTSW 15 83,543,226 (GRCm39) critical splice donor site probably null
R8098:Scube1 UTSW 15 83,543,289 (GRCm39) missense probably damaging 1.00
R8192:Scube1 UTSW 15 83,513,583 (GRCm39) critical splice donor site probably null
R8394:Scube1 UTSW 15 83,492,492 (GRCm39) missense probably damaging 1.00
R8441:Scube1 UTSW 15 83,494,423 (GRCm39) missense probably damaging 0.99
R8713:Scube1 UTSW 15 83,494,471 (GRCm39) missense possibly damaging 0.58
R8844:Scube1 UTSW 15 83,561,164 (GRCm39) missense probably damaging 1.00
R9090:Scube1 UTSW 15 83,494,394 (GRCm39) missense probably damaging 1.00
R9169:Scube1 UTSW 15 83,543,298 (GRCm39) missense possibly damaging 0.88
R9271:Scube1 UTSW 15 83,494,394 (GRCm39) missense probably damaging 1.00
R9334:Scube1 UTSW 15 83,512,264 (GRCm39) missense possibly damaging 0.72
R9363:Scube1 UTSW 15 83,499,080 (GRCm39) nonsense probably null
R9534:Scube1 UTSW 15 83,606,102 (GRCm39) missense probably damaging 1.00
R9569:Scube1 UTSW 15 83,513,605 (GRCm39) missense probably damaging 1.00
R9574:Scube1 UTSW 15 83,501,000 (GRCm39) missense
R9759:Scube1 UTSW 15 83,492,465 (GRCm39) missense probably benign 0.02
R9788:Scube1 UTSW 15 83,535,901 (GRCm39) missense possibly damaging 0.73
X0022:Scube1 UTSW 15 83,518,870 (GRCm39) critical splice donor site probably null
Z1177:Scube1 UTSW 15 83,496,617 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACTCCCTTGAGGTGCTGGTATC -3'
(R):5'- TTCTGACTTCCAGGCCAGTG -3'

Sequencing Primer
(F):5'- GCTCAGAGTCTAGCTGCTGTC -3'
(R):5'- GACTTCCAGGCCAGTGCTCTC -3'
Posted On 2019-10-24