Incidental Mutation 'R7599:Efcab6'
ID 587936
Institutional Source Beutler Lab
Gene Symbol Efcab6
Ensembl Gene ENSMUSG00000022441
Gene Name EF-hand calcium binding domain 6
Synonyms 4932408N08Rik, 4931407K02Rik
MMRRC Submission 045673-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7599 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 83750913-83949580 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 83755189 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Tryptophan at position 1376 (R1376W)
Ref Sequence ENSEMBL: ENSMUSP00000114909 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000156187]
AlphaFold Q6P1E8
Predicted Effect probably damaging
Transcript: ENSMUST00000156187
AA Change: R1376W

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000114909
Gene: ENSMUSG00000022441
AA Change: R1376W

DomainStartEndE-ValueType
EFh 100 128 9.33e-2 SMART
low complexity region 162 172 N/A INTRINSIC
EFh 201 229 5e-2 SMART
EFh 325 353 1.59e1 SMART
EFh 532 560 1.17e2 SMART
low complexity region 598 607 N/A INTRINSIC
EFh 659 687 8.82e1 SMART
EFh 767 795 3.71e0 SMART
low complexity region 802 816 N/A INTRINSIC
EFh 909 937 2.46e-1 SMART
low complexity region 962 977 N/A INTRINSIC
low complexity region 1015 1027 N/A INTRINSIC
low complexity region 1055 1070 N/A INTRINSIC
EFh 1090 1118 2.09e0 SMART
low complexity region 1131 1136 N/A INTRINSIC
EFh 1197 1225 2e1 SMART
Blast:EFh 1233 1261 1e-9 BLAST
EFh 1342 1370 3.48e-1 SMART
EFh 1453 1481 2.49e0 SMART
Blast:EFh 1489 1516 6e-9 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which directly binds the oncogene DJ-1 and androgen receptor to form a ternary complex in cells. This binding protein recruits histone-deacetylase complexes in order to repress transcription activity of androgen receptor. This protein may also play a role in spermatogenesis and fertilization. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2011]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts3 T C 5: 90,009,256 (GRCm39) S136G probably benign Het
Apba3 T A 10: 81,108,180 (GRCm39) N445K probably damaging Het
Aqp6 A G 15: 99,501,652 (GRCm39) K237E possibly damaging Het
Arhgap23 A G 11: 97,391,169 (GRCm39) T1229A probably benign Het
Bpifb1 T C 2: 154,056,071 (GRCm39) I379T probably damaging Het
Bpnt2 G A 4: 4,778,207 (GRCm39) T177I probably damaging Het
Ccdc169 A G 3: 55,047,530 (GRCm39) D7G probably damaging Het
Cyp2f2 T A 7: 26,830,784 (GRCm39) probably null Het
Daam2 T A 17: 49,787,755 (GRCm39) K453* probably null Het
Dennd4c T C 4: 86,729,849 (GRCm39) L817P probably damaging Het
Esrra G T 19: 6,891,214 (GRCm39) A182E possibly damaging Het
Fam234b T A 6: 135,203,874 (GRCm39) V392E probably damaging Het
Fanca A G 8: 123,997,999 (GRCm39) V1229A probably benign Het
Fdps G T 3: 89,006,693 (GRCm39) Q66K probably benign Het
Fer1l6 T A 15: 58,499,438 (GRCm39) D1269E probably benign Het
Foxred1 G A 9: 35,116,932 (GRCm39) R353W probably damaging Het
Gabrg2 C T 11: 41,858,451 (GRCm39) V226I possibly damaging Het
Gcnt2 C A 13: 41,014,343 (GRCm39) C171* probably null Het
Glyat C A 19: 12,617,172 (GRCm39) A8E probably damaging Het
Golgb1 C A 16: 36,695,758 (GRCm39) R86S unknown Het
Hc T A 2: 34,940,431 (GRCm39) T136S probably damaging Het
Hdac1 G T 4: 129,411,259 (GRCm39) S421* probably null Het
Hmcn2 G T 2: 31,246,298 (GRCm39) A756S possibly damaging Het
Igkv8-26 A G 6: 70,170,571 (GRCm39) N54S probably benign Het
Itgae T A 11: 73,012,786 (GRCm39) V706E possibly damaging Het
Itgax G A 7: 127,747,262 (GRCm39) V992M probably damaging Het
Klk10 A G 7: 43,433,851 (GRCm39) D221G probably benign Het
Klkb1 T C 8: 45,731,150 (GRCm39) I205V probably benign Het
Kpna2 T C 11: 106,889,583 (GRCm39) N8S probably null Het
L3mbtl1 A C 2: 162,806,434 (GRCm39) T442P possibly damaging Het
Lrp1b C T 2: 40,551,561 (GRCm39) C4181Y Het
Mcat T C 15: 83,431,872 (GRCm39) Y332C probably damaging Het
Mecom T C 3: 30,010,534 (GRCm39) D648G probably damaging Het
Mesp2 A T 7: 79,460,717 (GRCm39) D14V probably damaging Het
Mlh3 A T 12: 85,314,973 (GRCm39) Y404* probably null Het
Mterf3 A T 13: 67,065,212 (GRCm39) F230I probably damaging Het
Nrxn3 T C 12: 89,478,832 (GRCm39) V602A probably benign Het
Or4a74 T A 2: 89,439,571 (GRCm39) I292F possibly damaging Het
Plekhg6 A G 6: 125,351,623 (GRCm39) F209L probably damaging Het
Pmp22 C A 11: 63,049,174 (GRCm39) A139D probably damaging Het
Polr2e T C 10: 79,874,404 (GRCm39) D34G possibly damaging Het
Ppard T A 17: 28,516,091 (GRCm39) L105H probably damaging Het
Ptpn14 T A 1: 189,582,942 (GRCm39) D596E probably benign Het
Ptprz1 C T 6: 23,002,518 (GRCm39) A1536V not run Het
Qng1 T A 13: 58,529,649 (GRCm39) H321L probably damaging Het
Rabgap1 TGGGG TGGG 2: 37,392,908 (GRCm39) probably null Het
Retreg1 T A 15: 25,971,727 (GRCm39) D222E probably benign Het
Rmnd1 T C 10: 4,363,404 (GRCm39) K282R probably benign Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,229,111 (GRCm39) probably benign Het
Sall3 C T 18: 81,015,267 (GRCm39) R887H possibly damaging Het
Samd3 A G 10: 26,139,711 (GRCm39) D281G probably benign Het
Scube1 T A 15: 83,497,653 (GRCm39) D766V probably damaging Het
Sec24b TGC TGCAGC 3: 129,834,460 (GRCm39) probably benign Het
Slc2a2 A G 3: 28,752,166 (GRCm39) M1V probably null Het
Slc39a2 A T 14: 52,132,488 (GRCm39) T144S probably benign Het
Slc5a9 T C 4: 111,734,937 (GRCm39) H619R probably benign Het
Slco4a1 T C 2: 180,113,048 (GRCm39) F427L probably benign Het
Snapc3 C A 4: 83,336,073 (GRCm39) Y28* probably null Het
St3gal6 C T 16: 58,293,800 (GRCm39) R243H probably benign Het
Stat2 T A 10: 128,113,066 (GRCm39) N119K possibly damaging Het
Syne2 G C 12: 76,013,145 (GRCm39) V2779L probably benign Het
Tacc1 T A 8: 25,691,301 (GRCm39) M1L probably damaging Het
Tbc1d32 A T 10: 56,027,929 (GRCm39) F724L possibly damaging Het
Ttc23l A G 15: 10,533,766 (GRCm39) I259T possibly damaging Het
Ucn2 T C 9: 108,815,292 (GRCm39) I18T probably benign Het
Wdr35 G C 12: 9,074,886 (GRCm39) A1000P probably benign Het
Wnk1 C A 6: 119,906,789 (GRCm39) C244F possibly damaging Het
Zeb2 T G 2: 44,884,625 (GRCm39) D1022A probably damaging Het
Zfp26 A T 9: 20,349,129 (GRCm39) H478Q probably damaging Het
Zfp410 A G 12: 84,378,630 (GRCm39) K265R probably benign Het
Zfp575 T C 7: 24,286,093 (GRCm39) D21G probably benign Het
Other mutations in Efcab6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00819:Efcab6 APN 15 83,902,843 (GRCm39) missense probably benign 0.09
IGL00946:Efcab6 APN 15 83,902,897 (GRCm39) missense probably benign 0.19
IGL01063:Efcab6 APN 15 83,938,713 (GRCm39) start codon destroyed probably null 0.53
IGL01330:Efcab6 APN 15 83,928,501 (GRCm39) missense probably benign 0.26
IGL01372:Efcab6 APN 15 83,928,505 (GRCm39) missense possibly damaging 0.62
IGL01644:Efcab6 APN 15 83,917,273 (GRCm39) missense probably damaging 0.97
IGL02175:Efcab6 APN 15 83,780,301 (GRCm39) missense probably damaging 0.98
IGL02449:Efcab6 APN 15 83,894,234 (GRCm39) missense probably benign 0.00
IGL02514:Efcab6 APN 15 83,755,512 (GRCm39) splice site probably benign
IGL02514:Efcab6 APN 15 83,917,143 (GRCm39) missense possibly damaging 0.91
IGL02538:Efcab6 APN 15 83,938,722 (GRCm39) start gained probably benign
IGL02623:Efcab6 APN 15 83,763,649 (GRCm39) missense probably damaging 0.99
IGL02735:Efcab6 APN 15 83,783,898 (GRCm39) missense probably damaging 1.00
IGL03139:Efcab6 APN 15 83,836,422 (GRCm39) missense probably benign 0.04
IGL03274:Efcab6 APN 15 83,752,450 (GRCm39) missense probably damaging 1.00
IGL03400:Efcab6 APN 15 83,751,246 (GRCm39) utr 3 prime probably benign
P0045:Efcab6 UTSW 15 83,802,400 (GRCm39) missense probably damaging 1.00
PIT4445001:Efcab6 UTSW 15 83,788,468 (GRCm39) missense probably benign 0.03
PIT4486001:Efcab6 UTSW 15 83,857,514 (GRCm39) missense probably benign 0.00
PIT4618001:Efcab6 UTSW 15 83,867,647 (GRCm39) missense probably benign 0.25
R0520:Efcab6 UTSW 15 83,834,247 (GRCm39) missense probably benign 0.00
R0575:Efcab6 UTSW 15 83,851,901 (GRCm39) missense probably benign 0.28
R0648:Efcab6 UTSW 15 83,817,265 (GRCm39) splice site probably benign
R0894:Efcab6 UTSW 15 83,802,493 (GRCm39) missense probably benign 0.00
R0975:Efcab6 UTSW 15 83,857,532 (GRCm39) missense probably benign 0.00
R1238:Efcab6 UTSW 15 83,817,338 (GRCm39) missense probably benign 0.06
R1625:Efcab6 UTSW 15 83,831,839 (GRCm39) missense probably benign
R1651:Efcab6 UTSW 15 83,755,194 (GRCm39) missense possibly damaging 0.50
R1691:Efcab6 UTSW 15 83,817,407 (GRCm39) missense probably benign 0.01
R1844:Efcab6 UTSW 15 83,851,822 (GRCm39) missense possibly damaging 0.47
R1929:Efcab6 UTSW 15 83,777,163 (GRCm39) splice site probably benign
R1983:Efcab6 UTSW 15 83,777,163 (GRCm39) splice site probably benign
R2100:Efcab6 UTSW 15 83,777,168 (GRCm39) splice site probably null
R2271:Efcab6 UTSW 15 83,831,200 (GRCm39) missense probably benign
R2329:Efcab6 UTSW 15 83,834,249 (GRCm39) missense possibly damaging 0.90
R3618:Efcab6 UTSW 15 83,834,270 (GRCm39) missense probably benign 0.00
R3687:Efcab6 UTSW 15 83,755,479 (GRCm39) nonsense probably null
R3688:Efcab6 UTSW 15 83,755,479 (GRCm39) nonsense probably null
R4212:Efcab6 UTSW 15 83,777,064 (GRCm39) missense probably damaging 1.00
R4223:Efcab6 UTSW 15 83,751,309 (GRCm39) missense probably damaging 1.00
R4459:Efcab6 UTSW 15 83,788,490 (GRCm39) missense probably damaging 1.00
R4578:Efcab6 UTSW 15 83,817,369 (GRCm39) missense probably benign 0.00
R4600:Efcab6 UTSW 15 83,831,126 (GRCm39) missense probably benign
R5174:Efcab6 UTSW 15 83,938,687 (GRCm39) missense probably benign
R5260:Efcab6 UTSW 15 83,829,324 (GRCm39) missense probably benign 0.01
R5576:Efcab6 UTSW 15 83,834,201 (GRCm39) missense probably benign 0.05
R5718:Efcab6 UTSW 15 83,788,439 (GRCm39) missense probably damaging 1.00
R5797:Efcab6 UTSW 15 83,808,478 (GRCm39) missense possibly damaging 0.82
R6027:Efcab6 UTSW 15 83,851,922 (GRCm39) missense probably benign
R6110:Efcab6 UTSW 15 83,763,835 (GRCm39) missense possibly damaging 0.69
R6132:Efcab6 UTSW 15 83,917,173 (GRCm39) missense probably damaging 1.00
R6166:Efcab6 UTSW 15 83,780,316 (GRCm39) missense probably benign 0.01
R6228:Efcab6 UTSW 15 83,851,825 (GRCm39) missense possibly damaging 0.67
R6341:Efcab6 UTSW 15 83,820,139 (GRCm39) missense possibly damaging 0.65
R6445:Efcab6 UTSW 15 83,752,558 (GRCm39) missense probably damaging 1.00
R6494:Efcab6 UTSW 15 83,928,523 (GRCm39) critical splice acceptor site probably null
R6611:Efcab6 UTSW 15 83,777,036 (GRCm39) missense possibly damaging 0.68
R7392:Efcab6 UTSW 15 83,873,152 (GRCm39) missense probably benign 0.39
R7711:Efcab6 UTSW 15 83,834,125 (GRCm39) missense probably benign 0.00
R7873:Efcab6 UTSW 15 83,902,826 (GRCm39) critical splice donor site probably null
R8031:Efcab6 UTSW 15 83,867,699 (GRCm39) missense possibly damaging 0.90
R8075:Efcab6 UTSW 15 83,851,824 (GRCm39) missense probably damaging 0.99
R8209:Efcab6 UTSW 15 83,788,456 (GRCm39) missense probably benign 0.04
R8226:Efcab6 UTSW 15 83,788,456 (GRCm39) missense probably benign 0.04
R8710:Efcab6 UTSW 15 83,902,849 (GRCm39) missense probably benign 0.00
R8869:Efcab6 UTSW 15 83,928,432 (GRCm39) missense probably damaging 0.97
R8890:Efcab6 UTSW 15 83,829,349 (GRCm39) missense probably damaging 1.00
R9278:Efcab6 UTSW 15 83,777,094 (GRCm39) missense probably damaging 1.00
R9383:Efcab6 UTSW 15 83,756,620 (GRCm39) missense possibly damaging 0.85
R9641:Efcab6 UTSW 15 83,763,676 (GRCm39) missense probably damaging 0.98
X0019:Efcab6 UTSW 15 83,763,684 (GRCm39) missense possibly damaging 0.92
X0064:Efcab6 UTSW 15 83,867,694 (GRCm39) missense probably benign 0.08
Z1088:Efcab6 UTSW 15 83,839,210 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCTGACCAGCAGTACTTGG -3'
(R):5'- ATCTCTGCAGCTGAGTTCCTG -3'

Sequencing Primer
(F):5'- CCTGTGCCTCCAAGTGAG -3'
(R):5'- CAGCTGAGTTCCTGGGTTC -3'
Posted On 2019-10-24