Incidental Mutation 'R7599:St3gal6'
ID 587939
Institutional Source Beutler Lab
Gene Symbol St3gal6
Ensembl Gene ENSMUSG00000022747
Gene Name ST3 beta-galactoside alpha-2,3-sialyltransferase 6
Synonyms 1700023B24Rik, ST3Gal VI, Siat10
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.193) question?
Stock # R7599 (G1)
Quality Score 225.009
Status Not validated
Chromosome 16
Chromosomal Location 58468125-58524243 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 58473437 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Histidine at position 243 (R243H)
Ref Sequence ENSEMBL: ENSMUSP00000109997 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046663] [ENSMUST00000114357] [ENSMUST00000114358] [ENSMUST00000137035]
AlphaFold Q8VIB3
Predicted Effect probably benign
Transcript: ENSMUST00000046663
SMART Domains Protein: ENSMUSP00000039915
Gene: ENSMUSG00000035107

DomainStartEndE-ValueType
low complexity region 2 34 N/A INTRINSIC
CUB 69 184 4.26e-37 SMART
LCCL 188 273 4.74e-37 SMART
FA58C 288 446 4.08e-28 SMART
transmembrane domain 522 544 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114357
AA Change: R243H

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000109997
Gene: ENSMUSG00000022747
AA Change: R243H

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
Pfam:Glyco_transf_29 63 329 6.2e-70 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114358
AA Change: R243H

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000109998
Gene: ENSMUSG00000022747
AA Change: R243H

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
Pfam:Glyco_transf_29 71 329 7.1e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000137035
AA Change: R243H

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000115756
Gene: ENSMUSG00000022747
AA Change: R243H

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
Pfam:Glyco_transf_29 63 329 6.2e-70 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the sialyltransferase family. Members of this family are enzymes that transfer sialic acid from the activated cytidine 5'-monophospho-N-acetylneuraminic acid to terminal positions on sialylated glycolipids (gangliosides) or to the N- or O-linked sugar chains of glycoproteins. This protein has high specificity for neolactotetraosylceramide and neolactohexaosylceramide as glycolipid substrates and may contribute to the formation of selectin ligands and sialyl Lewis X, a carbohydrate important for cell-to-cell recognition and a blood group antigen. [provided by RefSeq, Apr 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit modest impairment in leukocyte rolling and neutrophil recruitment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210016F16Rik T A 13: 58,381,835 H321L probably damaging Het
Adamts3 T C 5: 89,861,397 S136G probably benign Het
Apba3 T A 10: 81,272,346 N445K probably damaging Het
Aqp6 A G 15: 99,603,771 K237E possibly damaging Het
Arhgap23 A G 11: 97,500,343 T1229A probably benign Het
Bpifb1 T C 2: 154,214,151 I379T probably damaging Het
Ccdc169 A G 3: 55,140,109 D7G probably damaging Het
Cyp2f2 T A 7: 27,131,359 probably null Het
Daam2 T A 17: 49,480,727 K453* probably null Het
Dennd4c T C 4: 86,811,612 L817P probably damaging Het
Efcab6 T A 15: 83,870,988 R1376W probably damaging Het
Esrra G T 19: 6,913,846 A182E possibly damaging Het
Fam234b T A 6: 135,226,876 V392E probably damaging Het
Fanca A G 8: 123,271,260 V1229A probably benign Het
Fdps G T 3: 89,099,386 Q66K probably benign Het
Fer1l6 T A 15: 58,627,589 D1269E probably benign Het
Foxred1 G A 9: 35,205,636 R353W probably damaging Het
Gabrg2 C T 11: 41,967,624 V226I possibly damaging Het
Gcnt2 C A 13: 40,860,867 C171* probably null Het
Glyat C A 19: 12,639,808 A8E probably damaging Het
Golgb1 C A 16: 36,875,396 R86S unknown Het
Hc T A 2: 35,050,419 T136S probably damaging Het
Hdac1 G T 4: 129,517,466 S421* probably null Het
Hmcn2 G T 2: 31,356,286 A756S possibly damaging Het
Igkv8-26 A G 6: 70,193,587 N54S probably benign Het
Impad1 G A 4: 4,778,207 T177I probably damaging Het
Itgae T A 11: 73,121,960 V706E possibly damaging Het
Itgax G A 7: 128,148,090 V992M probably damaging Het
Klk10 A G 7: 43,784,427 D221G probably benign Het
Klkb1 T C 8: 45,278,113 I205V probably benign Het
Kpna2 T C 11: 106,998,757 N8S probably null Het
L3mbtl1 A C 2: 162,964,514 T442P possibly damaging Het
Lrp1b C T 2: 40,661,549 C4181Y Het
Mcat T C 15: 83,547,671 Y332C probably damaging Het
Mecom T C 3: 29,956,385 D648G probably damaging Het
Mesp2 A T 7: 79,810,969 D14V probably damaging Het
Mlh3 A T 12: 85,268,199 Y404* probably null Het
Mterf3 A T 13: 66,917,148 F230I probably damaging Het
Nrxn3 T C 12: 89,512,062 V602A probably benign Het
Olfr1247 T A 2: 89,609,227 I292F possibly damaging Het
Plekhg6 A G 6: 125,374,660 F209L probably damaging Het
Pmp22 C A 11: 63,158,348 A139D probably damaging Het
Polr2e T C 10: 80,038,570 D34G possibly damaging Het
Ppard T A 17: 28,297,117 L105H probably damaging Het
Ptpn14 T A 1: 189,850,745 D596E probably benign Het
Ptprz1 C T 6: 23,002,519 A1536V not run Het
Rabgap1 TGGGG TGGG 2: 37,502,896 probably null Het
Retreg1 T A 15: 25,971,641 D222E probably benign Het
Rmnd1 T C 10: 4,413,404 K282R probably benign Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Sall3 C T 18: 80,972,052 R887H possibly damaging Het
Samd3 A G 10: 26,263,813 D281G probably benign Het
Scube1 T A 15: 83,613,452 D766V probably damaging Het
Sec24b TGC TGCAGC 3: 130,040,811 probably benign Het
Slc2a2 A G 3: 28,698,017 M1V probably null Het
Slc39a2 A T 14: 51,895,031 T144S probably benign Het
Slc5a9 T C 4: 111,877,740 H619R probably benign Het
Slco4a1 T C 2: 180,471,255 F427L probably benign Het
Snapc3 C A 4: 83,417,836 Y28* probably null Het
Stat2 T A 10: 128,277,197 N119K possibly damaging Het
Syne2 G C 12: 75,966,371 V2779L probably benign Het
Tacc1 T A 8: 25,201,285 M1L probably damaging Het
Tbc1d32 A T 10: 56,151,833 F724L possibly damaging Het
Ttc23l A G 15: 10,533,680 I259T possibly damaging Het
Ucn2 T C 9: 108,986,224 I18T probably benign Het
Wdr35 G C 12: 9,024,886 A1000P probably benign Het
Wnk1 C A 6: 119,929,828 C244F possibly damaging Het
Zeb2 T G 2: 44,994,613 D1022A probably damaging Het
Zfp26 A T 9: 20,437,833 H478Q probably damaging Het
Zfp410 A G 12: 84,331,856 K265R probably benign Het
Zfp575 T C 7: 24,586,668 D21G probably benign Het
Other mutations in St3gal6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01518:St3gal6 APN 16 58484775 missense probably benign 0.31
IGL01583:St3gal6 APN 16 58493670 unclassified probably benign
IGL02512:St3gal6 APN 16 58473459 missense probably benign 0.00
R0212:St3gal6 UTSW 16 58473453 missense probably damaging 0.96
R0212:St3gal6 UTSW 16 58473455 missense probably damaging 1.00
R0441:St3gal6 UTSW 16 58473453 missense probably damaging 0.96
R0441:St3gal6 UTSW 16 58473455 missense probably damaging 1.00
R0442:St3gal6 UTSW 16 58473453 missense probably damaging 0.96
R0442:St3gal6 UTSW 16 58473455 missense probably damaging 1.00
R1786:St3gal6 UTSW 16 58475871 missense probably damaging 1.00
R1939:St3gal6 UTSW 16 58473561 splice site probably null
R2233:St3gal6 UTSW 16 58473534 missense probably damaging 1.00
R2274:St3gal6 UTSW 16 58488969 missense possibly damaging 0.46
R2336:St3gal6 UTSW 16 58493704 missense probably damaging 1.00
R2434:St3gal6 UTSW 16 58470652 missense probably damaging 1.00
R3789:St3gal6 UTSW 16 58484773 missense probably benign 0.07
R6318:St3gal6 UTSW 16 58486406 missense probably benign 0.01
R7320:St3gal6 UTSW 16 58493711 missense probably benign 0.00
R8907:St3gal6 UTSW 16 58493732 missense probably benign 0.00
R9100:St3gal6 UTSW 16 58486430 missense
R9593:St3gal6 UTSW 16 58484773 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGTGTCCAACTTCATGAACAC -3'
(R):5'- TGGCTGGTGGAAATACTGCTAG -3'

Sequencing Primer
(F):5'- GTCCAACTTCATGAACACATCTATAG -3'
(R):5'- GGTTCAGATTATGTTCAGTATTTCCC -3'
Posted On 2019-10-24