Mutagenetix > Incidental Mutation

Incidental Mutation 'R7599:Sall3'

587942

Institutional Source

Beutler Lab

Gene Symbol

Sall3

Ensembl Gene

ENSMUSG00000024565

Gene Name

spalt like transcription factor 3

Synonyms

Msal, Spalt, Msal-1, Salt, B130022O04Rik

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7599 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

80966376-80986578 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 80972052 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Histidine at position 887 (R887H)

Ref Sequence

ENSEMBL: ENSMUSP00000056967 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000057950]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000057950
AA Change: R887H

PolyPhen 2 Score 0.565 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000056967
Gene: ENSMUSG00000024565
AA Change: R887H

Domain	Start	End	E-Value	Type
low complexity region	34	51	N/A	INTRINSIC
low complexity region	143	161	N/A	INTRINSIC
low complexity region	189	206	N/A	INTRINSIC
low complexity region	210	231	N/A	INTRINSIC
low complexity region	271	289	N/A	INTRINSIC
low complexity region	323	342	N/A	INTRINSIC
low complexity region	350	371	N/A	INTRINSIC
ZnF_C2H2	427	449	2.57e-3	SMART
ZnF_C2H2	455	477	3.21e-4	SMART
low complexity region	555	568	N/A	INTRINSIC
ZnF_C2H2	692	714	3.99e0	SMART
ZnF_C2H2	720	742	2.99e-4	SMART
ZnF_C2H2	752	774	1.6e-4	SMART
low complexity region	834	852	N/A	INTRINSIC
low complexity region	901	923	N/A	INTRINSIC
low complexity region	993	1007	N/A	INTRINSIC
ZnF_C2H2	1061	1083	1.69e-3	SMART
ZnF_C2H2	1089	1111	5.99e-4	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a sal-like C2H2-type zinc-finger protein, and belongs to a family of evolutionarily conserved genes found in species as diverse as Drosophila, C. elegans, and vertebrates. Mutations in some of these genes are associated with congenital disorders in human, suggesting their importance in embryonic development. This protein binds to DNA methyltransferase 3 alpha (DNMT3A), and reduces DNMT3A-mediated CpG island methylation. It is suggested that silencing of this gene, resulting in acceleration of DNA methylation, may have a role in oncogenesis. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous null mice display neonatal lethality with an impaired suckling ability, truncated soft palate, small epiglottis, and abnormal cranial nerve morphology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2210016F16Rik	T	A	13: 58,381,835	H321L	probably damaging	Het
Adamts3	T	C	5: 89,861,397	S136G	probably benign	Het
Apba3	T	A	10: 81,272,346	N445K	probably damaging	Het
Aqp6	A	G	15: 99,603,771	K237E	possibly damaging	Het
Arhgap23	A	G	11: 97,500,343	T1229A	probably benign	Het
Bpifb1	T	C	2: 154,214,151	I379T	probably damaging	Het
Ccdc169	A	G	3: 55,140,109	D7G	probably damaging	Het
Cyp2f2	T	A	7: 27,131,359		probably null	Het
Daam2	T	A	17: 49,480,727	K453*	probably null	Het
Dennd4c	T	C	4: 86,811,612	L817P	probably damaging	Het
Efcab6	T	A	15: 83,870,988	R1376W	probably damaging	Het
Esrra	G	T	19: 6,913,846	A182E	possibly damaging	Het
Fam234b	T	A	6: 135,226,876	V392E	probably damaging	Het
Fanca	A	G	8: 123,271,260	V1229A	probably benign	Het
Fdps	G	T	3: 89,099,386	Q66K	probably benign	Het
Fer1l6	T	A	15: 58,627,589	D1269E	probably benign	Het
Foxred1	G	A	9: 35,205,636	R353W	probably damaging	Het
Gabrg2	C	T	11: 41,967,624	V226I	possibly damaging	Het
Gcnt2	C	A	13: 40,860,867	C171*	probably null	Het
Glyat	C	A	19: 12,639,808	A8E	probably damaging	Het
Golgb1	C	A	16: 36,875,396	R86S	unknown	Het
Hc	T	A	2: 35,050,419	T136S	probably damaging	Het
Hdac1	G	T	4: 129,517,466	S421*	probably null	Het
Hmcn2	G	T	2: 31,356,286	A756S	possibly damaging	Het
Igkv8-26	A	G	6: 70,193,587	N54S	probably benign	Het
Impad1	G	A	4: 4,778,207	T177I	probably damaging	Het
Itgae	T	A	11: 73,121,960	V706E	possibly damaging	Het
Itgax	G	A	7: 128,148,090	V992M	probably damaging	Het
Klk10	A	G	7: 43,784,427	D221G	probably benign	Het
Klkb1	T	C	8: 45,278,113	I205V	probably benign	Het
Kpna2	T	C	11: 106,998,757	N8S	probably null	Het
L3mbtl1	A	C	2: 162,964,514	T442P	possibly damaging	Het
Lrp1b	C	T	2: 40,661,549	C4181Y		Het
Mcat	T	C	15: 83,547,671	Y332C	probably damaging	Het
Mecom	T	C	3: 29,956,385	D648G	probably damaging	Het
Mesp2	A	T	7: 79,810,969	D14V	probably damaging	Het
Mlh3	A	T	12: 85,268,199	Y404*	probably null	Het
Mterf3	A	T	13: 66,917,148	F230I	probably damaging	Het
Nrxn3	T	C	12: 89,512,062	V602A	probably benign	Het
Olfr1247	T	A	2: 89,609,227	I292F	possibly damaging	Het
Plekhg6	A	G	6: 125,374,660	F209L	probably damaging	Het
Pmp22	C	A	11: 63,158,348	A139D	probably damaging	Het
Polr2e	T	C	10: 80,038,570	D34G	possibly damaging	Het
Ppard	T	A	17: 28,297,117	L105H	probably damaging	Het
Ptpn14	T	A	1: 189,850,745	D596E	probably benign	Het
Ptprz1	C	T	6: 23,002,519	A1536V	not run	Het
Rabgap1	TGGGG	TGGG	2: 37,502,896		probably null	Het
Retreg1	T	A	15: 25,971,641	D222E	probably benign	Het
Rmnd1	T	C	10: 4,413,404	K282R	probably benign	Het
Rsf1	ATGGCG	ATGGCGACGGTGGCG	7: 97,579,904		probably benign	Het
Samd3	A	G	10: 26,263,813	D281G	probably benign	Het
Scube1	T	A	15: 83,613,452	D766V	probably damaging	Het
Sec24b	TGC	TGCAGC	3: 130,040,811		probably benign	Het
Slc2a2	A	G	3: 28,698,017	M1V	probably null	Het
Slc39a2	A	T	14: 51,895,031	T144S	probably benign	Het
Slc5a9	T	C	4: 111,877,740	H619R	probably benign	Het
Slco4a1	T	C	2: 180,471,255	F427L	probably benign	Het
Snapc3	C	A	4: 83,417,836	Y28*	probably null	Het
St3gal6	C	T	16: 58,473,437	R243H	probably benign	Het
Stat2	T	A	10: 128,277,197	N119K	possibly damaging	Het
Syne2	G	C	12: 75,966,371	V2779L	probably benign	Het
Tacc1	T	A	8: 25,201,285	M1L	probably damaging	Het
Tbc1d32	A	T	10: 56,151,833	F724L	possibly damaging	Het
Ttc23l	A	G	15: 10,533,680	I259T	possibly damaging	Het
Ucn2	T	C	9: 108,986,224	I18T	probably benign	Het
Wdr35	G	C	12: 9,024,886	A1000P	probably benign	Het
Wnk1	C	A	6: 119,929,828	C244F	possibly damaging	Het
Zeb2	T	G	2: 44,994,613	D1022A	probably damaging	Het
Zfp26	A	T	9: 20,437,833	H478Q	probably damaging	Het
Zfp410	A	G	12: 84,331,856	K265R	probably benign	Het
Zfp575	T	C	7: 24,586,668	D21G	probably benign	Het

Other mutations in Sall3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01088:Sall3	APN	18	80973232	missense	probably damaging	0.98
IGL01630:Sall3	APN	18	80971269	missense	probably benign	0.03
IGL01713:Sall3	APN	18	80969847	missense	probably damaging	1.00
IGL01803:Sall3	APN	18	80969832	missense	possibly damaging	0.65
IGL02627:Sall3	APN	18	80972361	missense	possibly damaging	0.86
IGL02858:Sall3	APN	18	80969513	missense	probably damaging	1.00
IGL03177:Sall3	APN	18	80972968	missense	probably benign	0.00
fountain	UTSW	18	80974476	missense	probably damaging	0.99
IGL02984:Sall3	UTSW	18	80973450	missense	probably benign	0.01
R1055:Sall3	UTSW	18	80969792	missense	probably benign	0.24
R1258:Sall3	UTSW	18	80974065	missense	probably damaging	1.00
R1932:Sall3	UTSW	18	80969753	missense	probably benign	0.44
R1976:Sall3	UTSW	18	80971893	missense	probably benign	0.42
R2124:Sall3	UTSW	18	80971797	missense	probably benign	0.01
R2142:Sall3	UTSW	18	80969831	missense	probably damaging	0.98
R2199:Sall3	UTSW	18	80971870	missense	probably benign	0.27
R2365:Sall3	UTSW	18	80971792	missense	probably benign	0.01
R3856:Sall3	UTSW	18	80972502	missense	probably damaging	1.00
R4022:Sall3	UTSW	18	80969840	missense	probably benign	0.05
R4050:Sall3	UTSW	18	80971482	missense	probably benign	0.03
R4085:Sall3	UTSW	18	80972133	missense	probably damaging	0.99
R4764:Sall3	UTSW	18	80974476	missense	probably damaging	0.99
R4874:Sall3	UTSW	18	80973973	missense	probably benign	0.33
R4948:Sall3	UTSW	18	80971411	missense	probably benign	0.20
R5274:Sall3	UTSW	18	80969837	missense	probably benign	0.15
R5602:Sall3	UTSW	18	80972812	missense	probably benign
R6063:Sall3	UTSW	18	80974255	missense	possibly damaging	0.52
R6256:Sall3	UTSW	18	80969861	missense	possibly damaging	0.74
R6431:Sall3	UTSW	18	80973187	missense	possibly damaging	0.94
R6523:Sall3	UTSW	18	80973188	missense	possibly damaging	0.68
R6719:Sall3	UTSW	18	80971506	missense	probably damaging	0.99
R6861:Sall3	UTSW	18	80974375	nonsense	probably null
R7078:Sall3	UTSW	18	80974099	missense	probably damaging	0.97
R7107:Sall3	UTSW	18	80973754	missense	probably benign	0.01
R7108:Sall3	UTSW	18	80973754	missense	probably benign	0.01
R7453:Sall3	UTSW	18	80972040	missense	probably benign	0.07
R7491:Sall3	UTSW	18	80972705	missense	probably benign	0.03
R7496:Sall3	UTSW	18	80973364	missense	probably benign	0.07
R7584:Sall3	UTSW	18	80974530	missense	probably benign	0.00
R7809:Sall3	UTSW	18	80974360	missense	probably benign	0.00
R8244:Sall3	UTSW	18	80973754	missense	probably benign	0.01
R8245:Sall3	UTSW	18	80973754	missense	probably benign	0.01
R8250:Sall3	UTSW	18	80973528	missense	probably benign	0.01
R8335:Sall3	UTSW	18	80969586	missense	probably benign	0.35
R8360:Sall3	UTSW	18	80974017	missense	probably benign	0.31
R8410:Sall3	UTSW	18	80973754	missense	probably benign	0.01
R8476:Sall3	UTSW	18	80972118	nonsense	probably null
R8712:Sall3	UTSW	18	80974021	missense	probably benign	0.03
R8726:Sall3	UTSW	18	80986493	missense	possibly damaging	0.89
R9192:Sall3	UTSW	18	80973909	missense	probably benign	0.05
R9653:Sall3	UTSW	18	80973013	missense	probably benign	0.03
R9701:Sall3	UTSW	18	80974228	missense	probably benign	0.07
Z1176:Sall3	UTSW	18	80972760	missense	probably benign	0.19
Z1177:Sall3	UTSW	18	80974276	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- CAGTCTTCAGTGGGATCTCCTG -3'
(R):5'- ATCGACGAGAACTCCATGGAGG -3'

Sequencing Primer
(F):5'- GGGATCTCCTGCGGATCTTC -3'
(R):5'- CTCGGAGCTGAAGGACAC -3'

Posted On

2019-10-24