Incidental Mutation 'R7599:Sall3'
ID 587942
Institutional Source Beutler Lab
Gene Symbol Sall3
Ensembl Gene ENSMUSG00000024565
Gene Name spalt like transcription factor 3
Synonyms Salt, B130022O04Rik, Spalt, Msal, Msal-1
MMRRC Submission 045673-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7599 (G1)
Quality Score 225.009
Status Not validated
Chromosome 18
Chromosomal Location 81010204-81030236 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 81015267 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Histidine at position 887 (R887H)
Ref Sequence ENSEMBL: ENSMUSP00000056967 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057950]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000057950
AA Change: R887H

PolyPhen 2 Score 0.565 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000056967
Gene: ENSMUSG00000024565
AA Change: R887H

DomainStartEndE-ValueType
low complexity region 34 51 N/A INTRINSIC
low complexity region 143 161 N/A INTRINSIC
low complexity region 189 206 N/A INTRINSIC
low complexity region 210 231 N/A INTRINSIC
low complexity region 271 289 N/A INTRINSIC
low complexity region 323 342 N/A INTRINSIC
low complexity region 350 371 N/A INTRINSIC
ZnF_C2H2 427 449 2.57e-3 SMART
ZnF_C2H2 455 477 3.21e-4 SMART
low complexity region 555 568 N/A INTRINSIC
ZnF_C2H2 692 714 3.99e0 SMART
ZnF_C2H2 720 742 2.99e-4 SMART
ZnF_C2H2 752 774 1.6e-4 SMART
low complexity region 834 852 N/A INTRINSIC
low complexity region 901 923 N/A INTRINSIC
low complexity region 993 1007 N/A INTRINSIC
ZnF_C2H2 1061 1083 1.69e-3 SMART
ZnF_C2H2 1089 1111 5.99e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a sal-like C2H2-type zinc-finger protein, and belongs to a family of evolutionarily conserved genes found in species as diverse as Drosophila, C. elegans, and vertebrates. Mutations in some of these genes are associated with congenital disorders in human, suggesting their importance in embryonic development. This protein binds to DNA methyltransferase 3 alpha (DNMT3A), and reduces DNMT3A-mediated CpG island methylation. It is suggested that silencing of this gene, resulting in acceleration of DNA methylation, may have a role in oncogenesis. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous null mice display neonatal lethality with an impaired suckling ability, truncated soft palate, small epiglottis, and abnormal cranial nerve morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts3 T C 5: 90,009,256 (GRCm39) S136G probably benign Het
Apba3 T A 10: 81,108,180 (GRCm39) N445K probably damaging Het
Aqp6 A G 15: 99,501,652 (GRCm39) K237E possibly damaging Het
Arhgap23 A G 11: 97,391,169 (GRCm39) T1229A probably benign Het
Bpifb1 T C 2: 154,056,071 (GRCm39) I379T probably damaging Het
Bpnt2 G A 4: 4,778,207 (GRCm39) T177I probably damaging Het
Ccdc169 A G 3: 55,047,530 (GRCm39) D7G probably damaging Het
Cyp2f2 T A 7: 26,830,784 (GRCm39) probably null Het
Daam2 T A 17: 49,787,755 (GRCm39) K453* probably null Het
Dennd4c T C 4: 86,729,849 (GRCm39) L817P probably damaging Het
Efcab6 T A 15: 83,755,189 (GRCm39) R1376W probably damaging Het
Esrra G T 19: 6,891,214 (GRCm39) A182E possibly damaging Het
Fam234b T A 6: 135,203,874 (GRCm39) V392E probably damaging Het
Fanca A G 8: 123,997,999 (GRCm39) V1229A probably benign Het
Fdps G T 3: 89,006,693 (GRCm39) Q66K probably benign Het
Fer1l6 T A 15: 58,499,438 (GRCm39) D1269E probably benign Het
Foxred1 G A 9: 35,116,932 (GRCm39) R353W probably damaging Het
Gabrg2 C T 11: 41,858,451 (GRCm39) V226I possibly damaging Het
Gcnt2 C A 13: 41,014,343 (GRCm39) C171* probably null Het
Glyat C A 19: 12,617,172 (GRCm39) A8E probably damaging Het
Golgb1 C A 16: 36,695,758 (GRCm39) R86S unknown Het
Hc T A 2: 34,940,431 (GRCm39) T136S probably damaging Het
Hdac1 G T 4: 129,411,259 (GRCm39) S421* probably null Het
Hmcn2 G T 2: 31,246,298 (GRCm39) A756S possibly damaging Het
Igkv8-26 A G 6: 70,170,571 (GRCm39) N54S probably benign Het
Itgae T A 11: 73,012,786 (GRCm39) V706E possibly damaging Het
Itgax G A 7: 127,747,262 (GRCm39) V992M probably damaging Het
Klk10 A G 7: 43,433,851 (GRCm39) D221G probably benign Het
Klkb1 T C 8: 45,731,150 (GRCm39) I205V probably benign Het
Kpna2 T C 11: 106,889,583 (GRCm39) N8S probably null Het
L3mbtl1 A C 2: 162,806,434 (GRCm39) T442P possibly damaging Het
Lrp1b C T 2: 40,551,561 (GRCm39) C4181Y Het
Mcat T C 15: 83,431,872 (GRCm39) Y332C probably damaging Het
Mecom T C 3: 30,010,534 (GRCm39) D648G probably damaging Het
Mesp2 A T 7: 79,460,717 (GRCm39) D14V probably damaging Het
Mlh3 A T 12: 85,314,973 (GRCm39) Y404* probably null Het
Mterf3 A T 13: 67,065,212 (GRCm39) F230I probably damaging Het
Nrxn3 T C 12: 89,478,832 (GRCm39) V602A probably benign Het
Or4a74 T A 2: 89,439,571 (GRCm39) I292F possibly damaging Het
Plekhg6 A G 6: 125,351,623 (GRCm39) F209L probably damaging Het
Pmp22 C A 11: 63,049,174 (GRCm39) A139D probably damaging Het
Polr2e T C 10: 79,874,404 (GRCm39) D34G possibly damaging Het
Ppard T A 17: 28,516,091 (GRCm39) L105H probably damaging Het
Ptpn14 T A 1: 189,582,942 (GRCm39) D596E probably benign Het
Ptprz1 C T 6: 23,002,518 (GRCm39) A1536V not run Het
Qng1 T A 13: 58,529,649 (GRCm39) H321L probably damaging Het
Rabgap1 TGGGG TGGG 2: 37,392,908 (GRCm39) probably null Het
Retreg1 T A 15: 25,971,727 (GRCm39) D222E probably benign Het
Rmnd1 T C 10: 4,363,404 (GRCm39) K282R probably benign Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,229,111 (GRCm39) probably benign Het
Samd3 A G 10: 26,139,711 (GRCm39) D281G probably benign Het
Scube1 T A 15: 83,497,653 (GRCm39) D766V probably damaging Het
Sec24b TGC TGCAGC 3: 129,834,460 (GRCm39) probably benign Het
Slc2a2 A G 3: 28,752,166 (GRCm39) M1V probably null Het
Slc39a2 A T 14: 52,132,488 (GRCm39) T144S probably benign Het
Slc5a9 T C 4: 111,734,937 (GRCm39) H619R probably benign Het
Slco4a1 T C 2: 180,113,048 (GRCm39) F427L probably benign Het
Snapc3 C A 4: 83,336,073 (GRCm39) Y28* probably null Het
St3gal6 C T 16: 58,293,800 (GRCm39) R243H probably benign Het
Stat2 T A 10: 128,113,066 (GRCm39) N119K possibly damaging Het
Syne2 G C 12: 76,013,145 (GRCm39) V2779L probably benign Het
Tacc1 T A 8: 25,691,301 (GRCm39) M1L probably damaging Het
Tbc1d32 A T 10: 56,027,929 (GRCm39) F724L possibly damaging Het
Ttc23l A G 15: 10,533,766 (GRCm39) I259T possibly damaging Het
Ucn2 T C 9: 108,815,292 (GRCm39) I18T probably benign Het
Wdr35 G C 12: 9,074,886 (GRCm39) A1000P probably benign Het
Wnk1 C A 6: 119,906,789 (GRCm39) C244F possibly damaging Het
Zeb2 T G 2: 44,884,625 (GRCm39) D1022A probably damaging Het
Zfp26 A T 9: 20,349,129 (GRCm39) H478Q probably damaging Het
Zfp410 A G 12: 84,378,630 (GRCm39) K265R probably benign Het
Zfp575 T C 7: 24,286,093 (GRCm39) D21G probably benign Het
Other mutations in Sall3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01088:Sall3 APN 18 81,016,447 (GRCm39) missense probably damaging 0.98
IGL01630:Sall3 APN 18 81,014,484 (GRCm39) missense probably benign 0.03
IGL01713:Sall3 APN 18 81,013,062 (GRCm39) missense probably damaging 1.00
IGL01803:Sall3 APN 18 81,013,047 (GRCm39) missense possibly damaging 0.65
IGL02627:Sall3 APN 18 81,015,576 (GRCm39) missense possibly damaging 0.86
IGL02858:Sall3 APN 18 81,012,728 (GRCm39) missense probably damaging 1.00
IGL03177:Sall3 APN 18 81,016,183 (GRCm39) missense probably benign 0.00
fountain UTSW 18 81,017,691 (GRCm39) missense probably damaging 0.99
IGL02984:Sall3 UTSW 18 81,016,665 (GRCm39) missense probably benign 0.01
R1055:Sall3 UTSW 18 81,013,007 (GRCm39) missense probably benign 0.24
R1258:Sall3 UTSW 18 81,017,280 (GRCm39) missense probably damaging 1.00
R1932:Sall3 UTSW 18 81,012,968 (GRCm39) missense probably benign 0.44
R1976:Sall3 UTSW 18 81,015,108 (GRCm39) missense probably benign 0.42
R2124:Sall3 UTSW 18 81,015,012 (GRCm39) missense probably benign 0.01
R2142:Sall3 UTSW 18 81,013,046 (GRCm39) missense probably damaging 0.98
R2199:Sall3 UTSW 18 81,015,085 (GRCm39) missense probably benign 0.27
R2365:Sall3 UTSW 18 81,015,007 (GRCm39) missense probably benign 0.01
R3856:Sall3 UTSW 18 81,015,717 (GRCm39) missense probably damaging 1.00
R4022:Sall3 UTSW 18 81,013,055 (GRCm39) missense probably benign 0.05
R4050:Sall3 UTSW 18 81,014,697 (GRCm39) missense probably benign 0.03
R4085:Sall3 UTSW 18 81,015,348 (GRCm39) missense probably damaging 0.99
R4764:Sall3 UTSW 18 81,017,691 (GRCm39) missense probably damaging 0.99
R4874:Sall3 UTSW 18 81,017,188 (GRCm39) missense probably benign 0.33
R4948:Sall3 UTSW 18 81,014,626 (GRCm39) missense probably benign 0.20
R5274:Sall3 UTSW 18 81,013,052 (GRCm39) missense probably benign 0.15
R5602:Sall3 UTSW 18 81,016,027 (GRCm39) missense probably benign
R6063:Sall3 UTSW 18 81,017,470 (GRCm39) missense possibly damaging 0.52
R6256:Sall3 UTSW 18 81,013,076 (GRCm39) missense possibly damaging 0.74
R6431:Sall3 UTSW 18 81,016,402 (GRCm39) missense possibly damaging 0.94
R6523:Sall3 UTSW 18 81,016,403 (GRCm39) missense possibly damaging 0.68
R6719:Sall3 UTSW 18 81,014,721 (GRCm39) missense probably damaging 0.99
R6861:Sall3 UTSW 18 81,017,590 (GRCm39) nonsense probably null
R7078:Sall3 UTSW 18 81,017,314 (GRCm39) missense probably damaging 0.97
R7107:Sall3 UTSW 18 81,016,969 (GRCm39) missense probably benign 0.01
R7108:Sall3 UTSW 18 81,016,969 (GRCm39) missense probably benign 0.01
R7453:Sall3 UTSW 18 81,015,255 (GRCm39) missense probably benign 0.07
R7491:Sall3 UTSW 18 81,015,920 (GRCm39) missense probably benign 0.03
R7496:Sall3 UTSW 18 81,016,579 (GRCm39) missense probably benign 0.07
R7584:Sall3 UTSW 18 81,017,745 (GRCm39) missense probably benign 0.00
R7809:Sall3 UTSW 18 81,017,575 (GRCm39) missense probably benign 0.00
R8244:Sall3 UTSW 18 81,016,969 (GRCm39) missense probably benign 0.01
R8245:Sall3 UTSW 18 81,016,969 (GRCm39) missense probably benign 0.01
R8250:Sall3 UTSW 18 81,016,743 (GRCm39) missense probably benign 0.01
R8335:Sall3 UTSW 18 81,012,801 (GRCm39) missense probably benign 0.35
R8360:Sall3 UTSW 18 81,017,232 (GRCm39) missense probably benign 0.31
R8410:Sall3 UTSW 18 81,016,969 (GRCm39) missense probably benign 0.01
R8476:Sall3 UTSW 18 81,015,333 (GRCm39) nonsense probably null
R8712:Sall3 UTSW 18 81,017,236 (GRCm39) missense probably benign 0.03
R8726:Sall3 UTSW 18 81,029,708 (GRCm39) missense possibly damaging 0.89
R9192:Sall3 UTSW 18 81,017,124 (GRCm39) missense probably benign 0.05
R9653:Sall3 UTSW 18 81,016,228 (GRCm39) missense probably benign 0.03
R9701:Sall3 UTSW 18 81,017,443 (GRCm39) missense probably benign 0.07
Z1176:Sall3 UTSW 18 81,015,975 (GRCm39) missense probably benign 0.19
Z1177:Sall3 UTSW 18 81,017,491 (GRCm39) missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CAGTCTTCAGTGGGATCTCCTG -3'
(R):5'- ATCGACGAGAACTCCATGGAGG -3'

Sequencing Primer
(F):5'- GGGATCTCCTGCGGATCTTC -3'
(R):5'- CTCGGAGCTGAAGGACAC -3'
Posted On 2019-10-24