Incidental Mutation 'R7600:Epb42'
ID587949
Institutional Source Beutler Lab
Gene Symbol Epb42
Ensembl Gene ENSMUSG00000023216
Gene Nameerythrocyte membrane protein band 4.2
SynonymsEpb4.2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7600 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location121017891-121037072 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 121021826 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 562 (L562P)
Ref Sequence ENSEMBL: ENSMUSP00000099548 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023987] [ENSMUST00000060455] [ENSMUST00000099489] [ENSMUST00000102490]
Predicted Effect probably benign
Transcript: ENSMUST00000023987
SMART Domains Protein: ENSMUSP00000023987
Gene: ENSMUSG00000023216

DomainStartEndE-ValueType
Pfam:Transglut_N 5 126 8.9e-35 PFAM
TGc 260 353 3.52e-27 SMART
low complexity region 442 458 N/A INTRINSIC
Pfam:Transglut_C 475 552 5.1e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000060455
SMART Domains Protein: ENSMUSP00000062496
Gene: ENSMUSG00000023572

DomainStartEndE-ValueType
Pfam:GCIP 50 318 4.2e-93 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000099489
SMART Domains Protein: ENSMUSP00000097088
Gene: ENSMUSG00000023572

DomainStartEndE-ValueType
Pfam:GCIP 3 271 3.7e-93 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000102490
AA Change: L562P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099548
Gene: ENSMUSG00000023216
AA Change: L562P

DomainStartEndE-ValueType
Pfam:Transglut_N 6 124 5.8e-34 PFAM
TGc 260 353 3.52e-27 SMART
low complexity region 442 458 N/A INTRINSIC
Pfam:Transglut_C 475 580 8e-23 PFAM
Pfam:Transglut_C 588 686 8.8e-26 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (45/45)
MGI Phenotype FUNCTION: The protein encoded by this gene is the key component of a macromolecular complex involved in the structure of erythrocytes. [provided by RefSeq, Aug 2015]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit erythrocytic abnormalities including mild spherocytosis, altered ion transport, and dehydration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam25 G A 8: 40,755,817 V707I probably benign Het
AF067063 A T 13: 119,828,696 probably null Het
Ahnak A T 19: 9,004,574 D1074V possibly damaging Het
Aldh4a1 A G 4: 139,645,004 M495V probably benign Het
Atxn1 T G 13: 45,557,060 K799Q possibly damaging Het
Catsperg2 A T 7: 29,704,858 S831T probably benign Het
Cldn1 T C 16: 26,360,919 T133A probably benign Het
Clec12b A G 6: 129,376,263 C254R probably damaging Het
Cnnm2 A T 19: 46,762,067 T99S probably benign Het
Col6a4 T G 9: 106,066,999 D1092A possibly damaging Het
Dnajc9 A G 14: 20,388,725 L20P probably damaging Het
Dsp C A 13: 38,191,715 Q1159K probably damaging Het
Dst C T 1: 34,266,930 T4110I probably damaging Het
Fras1 T C 5: 96,684,436 Y1543H probably damaging Het
Igkv1-117 T A 6: 68,121,116 V9E possibly damaging Het
Kbtbd8 T A 6: 95,122,592 Y361N probably damaging Het
Lrp1 C T 10: 127,555,706 R2948H probably benign Het
Lrp10 G T 14: 54,469,395 R563L possibly damaging Het
Mllt3 G T 4: 87,841,219 H197Q probably benign Het
Myo18b G A 5: 112,878,103 P27L unknown Het
Nlrp1a C A 11: 71,098,914 R1110L probably damaging Het
Nol10 T G 12: 17,369,480 D257E probably damaging Het
Olfm3 T C 3: 115,096,940 V114A possibly damaging Het
Olfr224 T C 11: 58,567,336 N3S probably benign Het
Olfr47 C A 6: 43,235,836 T76K probably damaging Het
Pdzd2 G T 15: 12,372,734 D2438E probably damaging Het
Prl7a2 T G 13: 27,659,281 I180L possibly damaging Het
Ptch2 A T 4: 117,096,225 probably benign Het
Snrpn A G 7: 59,988,603 M1T probably null Het
Sntb1 A T 15: 55,792,188 W211R possibly damaging Het
Sp110 G A 1: 85,579,092 R417C Het
Sytl2 T C 7: 90,376,144 S447P probably benign Het
Tas2r129 G T 6: 132,951,174 G25* probably null Het
Tle2 T G 10: 81,586,313 Y396* probably null Het
Trpm2 T C 10: 77,938,051 K510R probably benign Het
Trpm3 A G 19: 22,926,094 T1073A possibly damaging Het
Ttc24 A T 3: 88,072,013 M1K probably null Het
Tubgcp5 A G 7: 55,808,513 T391A probably benign Het
Vmn1r17 T C 6: 57,360,921 E153G probably benign Het
Vmn1r232 A T 17: 20,913,737 N200K possibly damaging Het
Zcwpw1 A T 5: 137,800,134 K198* probably null Het
Zfp142 A G 1: 74,573,668 V641A probably damaging Het
Zfp318 C T 17: 46,384,284 A149V possibly damaging Het
Zfp608 T C 18: 54,988,020 N165S probably damaging Het
Other mutations in Epb42
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01535:Epb42 APN 2 121027688 missense probably damaging 1.00
IGL01627:Epb42 APN 2 121025843 missense probably benign 0.06
IGL02059:Epb42 APN 2 121024707 missense probably damaging 0.96
IGL02869:Epb42 APN 2 121025746 missense probably benign
R0279:Epb42 UTSW 2 121029044 splice site probably benign
R0521:Epb42 UTSW 2 121029150 nonsense probably null
R1457:Epb42 UTSW 2 121029967 critical splice donor site probably null
R2157:Epb42 UTSW 2 121021762 missense probably benign
R2392:Epb42 UTSW 2 121029987 missense possibly damaging 0.85
R2407:Epb42 UTSW 2 121024752 missense probably damaging 1.00
R2866:Epb42 UTSW 2 121025921 missense possibly damaging 0.93
R2993:Epb42 UTSW 2 121029044 splice site probably benign
R3426:Epb42 UTSW 2 121030039 missense probably damaging 1.00
R3427:Epb42 UTSW 2 121030039 missense probably damaging 1.00
R4192:Epb42 UTSW 2 121030089 splice site probably null
R4940:Epb42 UTSW 2 121034451 missense probably damaging 1.00
R5368:Epb42 UTSW 2 121019462 missense probably benign 0.22
R5771:Epb42 UTSW 2 121021820 missense probably damaging 0.99
R6048:Epb42 UTSW 2 121024408 missense probably benign 0.00
R6362:Epb42 UTSW 2 121025779 missense possibly damaging 0.72
R6475:Epb42 UTSW 2 121027133 missense possibly damaging 0.53
R6711:Epb42 UTSW 2 121024108 intron probably benign
R6843:Epb42 UTSW 2 121027685 missense possibly damaging 0.85
R6895:Epb42 UTSW 2 121036623 start gained probably benign
R7154:Epb42 UTSW 2 121033362 missense probably benign 0.01
R7192:Epb42 UTSW 2 121024097 missense unknown
R7757:Epb42 UTSW 2 121027719 missense possibly damaging 0.91
R7779:Epb42 UTSW 2 121034435 missense probably benign 0.14
R7781:Epb42 UTSW 2 121034435 missense probably benign 0.14
R7782:Epb42 UTSW 2 121034435 missense probably benign 0.14
R7783:Epb42 UTSW 2 121034435 missense probably benign 0.14
R7784:Epb42 UTSW 2 121034435 missense probably benign 0.14
Z1177:Epb42 UTSW 2 121027725 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACTGATAGACTCTGGGGAAGG -3'
(R):5'- GTCTTCTGTGAGACCCCAAGTC -3'

Sequencing Primer
(F):5'- AGGGACAGTCATCGATTTCAAGTGTC -3'
(R):5'- CAAGTCCCGTGTCGTAGGTG -3'
Posted On2019-10-24