Incidental Mutation 'R7600:Olfm3'
ID587951
Institutional Source Beutler Lab
Gene Symbol Olfm3
Ensembl Gene ENSMUSG00000027965
Gene Nameolfactomedin 3
Synonymsoptimedin, B230206G02Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.124) question?
Stock #R7600 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location114904078-115125722 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 115096940 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 114 (V114A)
Ref Sequence ENSEMBL: ENSMUSP00000060985 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051309] [ENSMUST00000081752] [ENSMUST00000149158]
Predicted Effect possibly damaging
Transcript: ENSMUST00000051309
AA Change: V114A

PolyPhen 2 Score 0.647 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000060985
Gene: ENSMUSG00000027965
AA Change: V114A

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:Noelin-1 46 145 3.9e-52 PFAM
Blast:OLF 162 207 3e-8 BLAST
OLF 220 470 4.33e-114 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000081752
AA Change: V94A

PolyPhen 2 Score 0.870 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000080448
Gene: ENSMUSG00000027965
AA Change: V94A

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Noelin-1 25 125 7.6e-54 PFAM
Blast:OLF 142 187 3e-8 BLAST
OLF 200 450 4.33e-114 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000149158
AA Change: V81A

PolyPhen 2 Score 0.496 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000121097
Gene: ENSMUSG00000027965
AA Change: V81A

DomainStartEndE-ValueType
Pfam:Noelin-1 12 112 2.5e-51 PFAM
Blast:OLF 129 174 1e-8 BLAST
Blast:OLF 187 210 1e-7 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (45/45)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam25 G A 8: 40,755,817 V707I probably benign Het
AF067063 A T 13: 119,828,696 probably null Het
Ahnak A T 19: 9,004,574 D1074V possibly damaging Het
Aldh4a1 A G 4: 139,645,004 M495V probably benign Het
Atxn1 T G 13: 45,557,060 K799Q possibly damaging Het
Catsperg2 A T 7: 29,704,858 S831T probably benign Het
Cldn1 T C 16: 26,360,919 T133A probably benign Het
Clec12b A G 6: 129,376,263 C254R probably damaging Het
Cnnm2 A T 19: 46,762,067 T99S probably benign Het
Col6a4 T G 9: 106,066,999 D1092A possibly damaging Het
Dnajc9 A G 14: 20,388,725 L20P probably damaging Het
Dsp C A 13: 38,191,715 Q1159K probably damaging Het
Dst C T 1: 34,266,930 T4110I probably damaging Het
Epb42 A G 2: 121,021,826 L562P probably damaging Het
Fras1 T C 5: 96,684,436 Y1543H probably damaging Het
Igkv1-117 T A 6: 68,121,116 V9E possibly damaging Het
Kbtbd8 T A 6: 95,122,592 Y361N probably damaging Het
Lrp1 C T 10: 127,555,706 R2948H probably benign Het
Lrp10 G T 14: 54,469,395 R563L possibly damaging Het
Mllt3 G T 4: 87,841,219 H197Q probably benign Het
Myo18b G A 5: 112,878,103 P27L unknown Het
Nlrp1a C A 11: 71,098,914 R1110L probably damaging Het
Nol10 T G 12: 17,369,480 D257E probably damaging Het
Olfr224 T C 11: 58,567,336 N3S probably benign Het
Olfr47 C A 6: 43,235,836 T76K probably damaging Het
Pdzd2 G T 15: 12,372,734 D2438E probably damaging Het
Prl7a2 T G 13: 27,659,281 I180L possibly damaging Het
Ptch2 A T 4: 117,096,225 probably benign Het
Snrpn A G 7: 59,988,603 M1T probably null Het
Sntb1 A T 15: 55,792,188 W211R possibly damaging Het
Sp110 G A 1: 85,579,092 R417C Het
Sytl2 T C 7: 90,376,144 S447P probably benign Het
Tas2r129 G T 6: 132,951,174 G25* probably null Het
Tle2 T G 10: 81,586,313 Y396* probably null Het
Trpm2 T C 10: 77,938,051 K510R probably benign Het
Trpm3 A G 19: 22,926,094 T1073A possibly damaging Het
Ttc24 A T 3: 88,072,013 M1K probably null Het
Tubgcp5 A G 7: 55,808,513 T391A probably benign Het
Vmn1r17 T C 6: 57,360,921 E153G probably benign Het
Vmn1r232 A T 17: 20,913,737 N200K possibly damaging Het
Zcwpw1 A T 5: 137,800,134 K198* probably null Het
Zfp142 A G 1: 74,573,668 V641A probably damaging Het
Zfp318 C T 17: 46,384,284 A149V possibly damaging Het
Zfp608 T C 18: 54,988,020 N165S probably damaging Het
Other mutations in Olfm3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01656:Olfm3 APN 3 115122633 missense probably damaging 1.00
IGL01686:Olfm3 APN 3 115122848 missense probably benign 0.00
IGL01732:Olfm3 APN 3 115097000 missense possibly damaging 0.82
IGL02539:Olfm3 APN 3 115101930 missense possibly damaging 0.93
IGL02580:Olfm3 APN 3 115122508 missense probably damaging 1.00
IGL02999:Olfm3 APN 3 115122748 missense probably damaging 1.00
IGL03142:Olfm3 APN 3 115097030 missense probably damaging 0.97
IGL03239:Olfm3 APN 3 115122594 missense probably damaging 0.99
R0361:Olfm3 UTSW 3 115120973 missense probably damaging 1.00
R0373:Olfm3 UTSW 3 115122805 missense probably damaging 0.99
R0505:Olfm3 UTSW 3 115122681 missense possibly damaging 0.46
R0689:Olfm3 UTSW 3 115122545 missense probably benign 0.28
R0973:Olfm3 UTSW 3 115101986 missense probably benign 0.00
R0973:Olfm3 UTSW 3 115101986 missense probably benign 0.00
R0974:Olfm3 UTSW 3 115101986 missense probably benign 0.00
R1253:Olfm3 UTSW 3 115122769 missense probably damaging 0.98
R1293:Olfm3 UTSW 3 115101930 missense possibly damaging 0.93
R1952:Olfm3 UTSW 3 115101940 missense probably null 1.00
R2255:Olfm3 UTSW 3 115122193 splice site probably null
R2334:Olfm3 UTSW 3 115101959 nonsense probably null
R2510:Olfm3 UTSW 3 115122310 missense probably damaging 1.00
R4222:Olfm3 UTSW 3 115090171 nonsense probably null
R4716:Olfm3 UTSW 3 115081106 missense probably benign 0.00
R4912:Olfm3 UTSW 3 115101940 missense probably damaging 1.00
R5084:Olfm3 UTSW 3 114904553 critical splice donor site probably null
R5649:Olfm3 UTSW 3 115096924 missense probably damaging 0.99
R5681:Olfm3 UTSW 3 115122275 missense probably benign 0.28
R5861:Olfm3 UTSW 3 115122403 missense probably damaging 1.00
R5924:Olfm3 UTSW 3 115122538 missense probably benign 0.44
R5929:Olfm3 UTSW 3 115101880 missense probably damaging 0.97
R5958:Olfm3 UTSW 3 115122306 missense probably damaging 0.99
R6166:Olfm3 UTSW 3 115122425 missense probably damaging 1.00
R6299:Olfm3 UTSW 3 115120983 missense probably damaging 1.00
R6804:Olfm3 UTSW 3 115122679 missense probably benign 0.10
R7032:Olfm3 UTSW 3 115090156 missense probably damaging 1.00
R7565:Olfm3 UTSW 3 115122744 missense probably damaging 0.98
R7976:Olfm3 UTSW 3 115081145 missense probably benign 0.00
R8070:Olfm3 UTSW 3 115101955 missense probably damaging 0.96
R8334:Olfm3 UTSW 3 115122557 missense probably damaging 0.96
Z1088:Olfm3 UTSW 3 114904668 start gained probably benign
Z1177:Olfm3 UTSW 3 115081101 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GGGTATTATCACCTTTTGAAGCC -3'
(R):5'- ACTTGGTGAATGGGCACAGG -3'

Sequencing Primer
(F):5'- TGAGACAACAGACATTTATTTGCC -3'
(R):5'- GGGCACAGGAATAGTTATTTCCAAC -3'
Posted On2019-10-24