Incidental Mutation 'R7600:Aldh4a1'
ID587956
Institutional Source Beutler Lab
Gene Symbol Aldh4a1
Ensembl Gene ENSMUSG00000028737
Gene Namealdehyde dehydrogenase 4 family, member A1
SynonymsP5CDH, Ssdh1, A930035F14Rik, ALDH4, Ahd1, Ahd-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.127) question?
Stock #R7600 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location139622866-139649690 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 139645004 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 495 (M495V)
Ref Sequence ENSEMBL: ENSMUSP00000043821 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039818] [ENSMUST00000178644]
PDB Structure
Crystal structure of mouse 1-pyrroline-5-carboxylate dehydrogenase complexed with sulfate ion [X-RAY DIFFRACTION]
Crystal structure of mouse 1-pyrroline-5-carboxylate dehydrogenase complexed with the product glutamate [X-RAY DIFFRACTION]
Crystal structure of mouse 1-pyrroline-5-carboxylate dehydrogenase complexed with NAD+ [X-RAY DIFFRACTION]
Crystal Structure of Mus musculus 1-pyrroline-5-carboxylate dehydrogenase cryoprotected in proline [X-RAY DIFFRACTION]
Structure of mouse 1-Pyrroline-5-Carboxylate Dehydrogenase (ALDH4A1) complexed with acetate [X-RAY DIFFRACTION]
Structure of mouse 1-Pyrroline-5-Carboxylate Dehydrogenase (ALDH4A1) complexed with glyoxylate [X-RAY DIFFRACTION]
Structure of mouse 1-Pyrroline-5-Carboxylate Dehydrogenase (ALDH4A1) complexed with malonate [X-RAY DIFFRACTION]
Structure of mouse 1-Pyrroline-5-Carboxylate Dehydrogenase (ALDH4A1) complexed with succinate [X-RAY DIFFRACTION]
Structure of mouse 1-Pyrroline-5-Carboxylate Dehydrogenase (ALDH4A1) complexed with glutarate [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000039818
AA Change: M495V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000043821
Gene: ENSMUSG00000028737
AA Change: M495V

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:Aldedh 73 546 7.6e-104 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000178644
SMART Domains Protein: ENSMUSP00000136776
Gene: ENSMUSG00000094439

DomainStartEndE-ValueType
SCOP:d1lbva_ 1 60 5e-3 SMART
Pfam:Filament 165 253 7.3e-13 PFAM
low complexity region 255 268 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (45/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This protein belongs to the aldehyde dehydrogenase family of proteins. This enzyme is a mitochondrial matrix NAD-dependent dehydrogenase which catalyzes the second step of the proline degradation pathway, converting pyrroline-5-carboxylate to glutamate. Deficiency of this enzyme is associated with type II hyperprolinemia, an autosomal recessive disorder characterized by accumulation of delta-1-pyrroline-5-carboxylate (P5C) and proline. Alternatively spliced transcript variants encoding different isoforms have been identified for this gene. [provided by RefSeq, Jun 2009]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam25 G A 8: 40,755,817 V707I probably benign Het
AF067063 A T 13: 119,828,696 probably null Het
Ahnak A T 19: 9,004,574 D1074V possibly damaging Het
Atxn1 T G 13: 45,557,060 K799Q possibly damaging Het
Catsperg2 A T 7: 29,704,858 S831T probably benign Het
Cldn1 T C 16: 26,360,919 T133A probably benign Het
Clec12b A G 6: 129,376,263 C254R probably damaging Het
Cnnm2 A T 19: 46,762,067 T99S probably benign Het
Col6a4 T G 9: 106,066,999 D1092A possibly damaging Het
Dnajc9 A G 14: 20,388,725 L20P probably damaging Het
Dsp C A 13: 38,191,715 Q1159K probably damaging Het
Dst C T 1: 34,266,930 T4110I probably damaging Het
Epb42 A G 2: 121,021,826 L562P probably damaging Het
Fras1 T C 5: 96,684,436 Y1543H probably damaging Het
Igkv1-117 T A 6: 68,121,116 V9E possibly damaging Het
Kbtbd8 T A 6: 95,122,592 Y361N probably damaging Het
Lrp1 C T 10: 127,555,706 R2948H probably benign Het
Lrp10 G T 14: 54,469,395 R563L possibly damaging Het
Mllt3 G T 4: 87,841,219 H197Q probably benign Het
Myo18b G A 5: 112,878,103 P27L unknown Het
Nlrp1a C A 11: 71,098,914 R1110L probably damaging Het
Nol10 T G 12: 17,369,480 D257E probably damaging Het
Olfm3 T C 3: 115,096,940 V114A possibly damaging Het
Olfr224 T C 11: 58,567,336 N3S probably benign Het
Olfr47 C A 6: 43,235,836 T76K probably damaging Het
Pdzd2 G T 15: 12,372,734 D2438E probably damaging Het
Prl7a2 T G 13: 27,659,281 I180L possibly damaging Het
Ptch2 A T 4: 117,096,225 probably benign Het
Snrpn A G 7: 59,988,603 M1T probably null Het
Sntb1 A T 15: 55,792,188 W211R possibly damaging Het
Sp110 G A 1: 85,579,092 R417C Het
Sytl2 T C 7: 90,376,144 S447P probably benign Het
Tas2r129 G T 6: 132,951,174 G25* probably null Het
Tle2 T G 10: 81,586,313 Y396* probably null Het
Trpm2 T C 10: 77,938,051 K510R probably benign Het
Trpm3 A G 19: 22,926,094 T1073A possibly damaging Het
Ttc24 A T 3: 88,072,013 M1K probably null Het
Tubgcp5 A G 7: 55,808,513 T391A probably benign Het
Vmn1r17 T C 6: 57,360,921 E153G probably benign Het
Vmn1r232 A T 17: 20,913,737 N200K possibly damaging Het
Zcwpw1 A T 5: 137,800,134 K198* probably null Het
Zfp142 A G 1: 74,573,668 V641A probably damaging Het
Zfp318 C T 17: 46,384,284 A149V possibly damaging Het
Zfp608 T C 18: 54,988,020 N165S probably damaging Het
Other mutations in Aldh4a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01732:Aldh4a1 APN 4 139642160 nonsense probably null
IGL01916:Aldh4a1 APN 4 139644146 missense probably damaging 1.00
IGL02368:Aldh4a1 APN 4 139648200 nonsense probably null
IGL02469:Aldh4a1 APN 4 139648161 missense probably damaging 0.98
PIT4402001:Aldh4a1 UTSW 4 139642191 nonsense probably null
R0511:Aldh4a1 UTSW 4 139642571 splice site probably benign
R1352:Aldh4a1 UTSW 4 139635519 missense probably benign 0.18
R1484:Aldh4a1 UTSW 4 139643447 missense probably benign 0.00
R1717:Aldh4a1 UTSW 4 139638529 missense possibly damaging 0.93
R1717:Aldh4a1 UTSW 4 139633994 splice site probably null
R1729:Aldh4a1 UTSW 4 139644161 missense probably damaging 1.00
R1784:Aldh4a1 UTSW 4 139644161 missense probably damaging 1.00
R1785:Aldh4a1 UTSW 4 139644128 missense probably benign 0.01
R1786:Aldh4a1 UTSW 4 139644128 missense probably benign 0.01
R3696:Aldh4a1 UTSW 4 139642251 missense possibly damaging 0.68
R3697:Aldh4a1 UTSW 4 139642251 missense possibly damaging 0.68
R3698:Aldh4a1 UTSW 4 139642251 missense possibly damaging 0.68
R4603:Aldh4a1 UTSW 4 139643429 missense probably damaging 0.97
R5197:Aldh4a1 UTSW 4 139648301 intron probably benign
R5375:Aldh4a1 UTSW 4 139633922 missense probably benign
R5539:Aldh4a1 UTSW 4 139638522 missense probably benign 0.05
R5590:Aldh4a1 UTSW 4 139642104 missense probably damaging 1.00
R6101:Aldh4a1 UTSW 4 139638495 missense possibly damaging 0.91
R6105:Aldh4a1 UTSW 4 139638495 missense possibly damaging 0.91
R7666:Aldh4a1 UTSW 4 139633957 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCCAGAAGGCCAGTGAGCTAAC -3'
(R):5'- AAGCTCCTGAAAAGACCGTG -3'

Sequencing Primer
(F):5'- AGTGAGCTAACCCCCTTCTCG -3'
(R):5'- AAGACCGTGTTTGGACATCC -3'
Posted On2019-10-24