Incidental Mutation 'R7600:Zcwpw1'
ID587959
Institutional Source Beutler Lab
Gene Symbol Zcwpw1
Ensembl Gene ENSMUSG00000037108
Gene Namezinc finger, CW type with PWWP domain 1
SynonymsLOC381678
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.123) question?
Stock #R7600 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location137787798-137822621 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 137800134 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 198 (K198*)
Ref Sequence ENSEMBL: ENSMUSP00000048730 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035852]
Predicted Effect probably null
Transcript: ENSMUST00000035852
AA Change: K198*
SMART Domains Protein: ENSMUSP00000048730
Gene: ENSMUSG00000037108
AA Change: K198*

DomainStartEndE-ValueType
Pfam:zf-CW 246 293 7.3e-18 PFAM
Pfam:PWWP 306 401 6.9e-22 PFAM
coiled coil region 440 462 N/A INTRINSIC
low complexity region 587 598 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (45/45)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam25 G A 8: 40,755,817 V707I probably benign Het
AF067063 A T 13: 119,828,696 probably null Het
Ahnak A T 19: 9,004,574 D1074V possibly damaging Het
Aldh4a1 A G 4: 139,645,004 M495V probably benign Het
Atxn1 T G 13: 45,557,060 K799Q possibly damaging Het
Catsperg2 A T 7: 29,704,858 S831T probably benign Het
Cldn1 T C 16: 26,360,919 T133A probably benign Het
Clec12b A G 6: 129,376,263 C254R probably damaging Het
Cnnm2 A T 19: 46,762,067 T99S probably benign Het
Col6a4 T G 9: 106,066,999 D1092A possibly damaging Het
Dnajc9 A G 14: 20,388,725 L20P probably damaging Het
Dsp C A 13: 38,191,715 Q1159K probably damaging Het
Dst C T 1: 34,266,930 T4110I probably damaging Het
Epb42 A G 2: 121,021,826 L562P probably damaging Het
Fras1 T C 5: 96,684,436 Y1543H probably damaging Het
Igkv1-117 T A 6: 68,121,116 V9E possibly damaging Het
Kbtbd8 T A 6: 95,122,592 Y361N probably damaging Het
Lrp1 C T 10: 127,555,706 R2948H probably benign Het
Lrp10 G T 14: 54,469,395 R563L possibly damaging Het
Mllt3 G T 4: 87,841,219 H197Q probably benign Het
Myo18b G A 5: 112,878,103 P27L unknown Het
Nlrp1a C A 11: 71,098,914 R1110L probably damaging Het
Nol10 T G 12: 17,369,480 D257E probably damaging Het
Olfm3 T C 3: 115,096,940 V114A possibly damaging Het
Olfr224 T C 11: 58,567,336 N3S probably benign Het
Olfr47 C A 6: 43,235,836 T76K probably damaging Het
Pdzd2 G T 15: 12,372,734 D2438E probably damaging Het
Prl7a2 T G 13: 27,659,281 I180L possibly damaging Het
Ptch2 A T 4: 117,096,225 probably benign Het
Snrpn A G 7: 59,988,603 M1T probably null Het
Sntb1 A T 15: 55,792,188 W211R possibly damaging Het
Sp110 G A 1: 85,579,092 R417C Het
Sytl2 T C 7: 90,376,144 S447P probably benign Het
Tas2r129 G T 6: 132,951,174 G25* probably null Het
Tle2 T G 10: 81,586,313 Y396* probably null Het
Trpm2 T C 10: 77,938,051 K510R probably benign Het
Trpm3 A G 19: 22,926,094 T1073A possibly damaging Het
Ttc24 A T 3: 88,072,013 M1K probably null Het
Tubgcp5 A G 7: 55,808,513 T391A probably benign Het
Vmn1r17 T C 6: 57,360,921 E153G probably benign Het
Vmn1r232 A T 17: 20,913,737 N200K possibly damaging Het
Zfp142 A G 1: 74,573,668 V641A probably damaging Het
Zfp318 C T 17: 46,384,284 A149V possibly damaging Het
Zfp608 T C 18: 54,988,020 N165S probably damaging Het
Other mutations in Zcwpw1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01296:Zcwpw1 APN 5 137796799 missense probably benign 0.42
IGL02316:Zcwpw1 APN 5 137810010 unclassified probably benign
IGL02336:Zcwpw1 APN 5 137810114 missense probably damaging 0.96
R0103:Zcwpw1 UTSW 5 137810113 nonsense probably null
R0103:Zcwpw1 UTSW 5 137810113 nonsense probably null
R0295:Zcwpw1 UTSW 5 137817472 missense probably damaging 1.00
R0514:Zcwpw1 UTSW 5 137796683 missense probably benign 0.26
R0685:Zcwpw1 UTSW 5 137799592 missense probably benign 0.00
R0698:Zcwpw1 UTSW 5 137817521 missense probably benign
R0727:Zcwpw1 UTSW 5 137810807 unclassified probably benign
R1677:Zcwpw1 UTSW 5 137796760 missense probably damaging 0.99
R1780:Zcwpw1 UTSW 5 137796652 missense probably damaging 0.98
R1938:Zcwpw1 UTSW 5 137811622 missense probably damaging 0.99
R2875:Zcwpw1 UTSW 5 137810042 missense probably damaging 1.00
R4177:Zcwpw1 UTSW 5 137800133 missense probably damaging 0.99
R5073:Zcwpw1 UTSW 5 137795519 start codon destroyed probably null 0.81
R5913:Zcwpw1 UTSW 5 137800007 missense probably benign 0.31
R6224:Zcwpw1 UTSW 5 137812036 missense possibly damaging 0.63
R6542:Zcwpw1 UTSW 5 137812020 missense probably damaging 0.98
R7204:Zcwpw1 UTSW 5 137812084 missense probably damaging 0.98
R7542:Zcwpw1 UTSW 5 137819523 missense probably benign 0.00
R7911:Zcwpw1 UTSW 5 137796770 missense probably null 1.00
R7972:Zcwpw1 UTSW 5 137801061 missense probably benign 0.13
R7988:Zcwpw1 UTSW 5 137817491 missense possibly damaging 0.69
R8174:Zcwpw1 UTSW 5 137819577 critical splice donor site probably null
X0021:Zcwpw1 UTSW 5 137811607 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGGCAAGTGTCTCTCTGAAG -3'
(R):5'- GGTTTAAAGGATATCTGGGATCTAGAG -3'

Sequencing Primer
(F):5'- GGAAGTGAATTCTGAGATGG -3'
(R):5'- CTTTGGGAACTGCAACCCTATAGG -3'
Posted On2019-10-24