Incidental Mutation 'R7600:Olfr47'
ID587960
Institutional Source Beutler Lab
Gene Symbol Olfr47
Ensembl Gene ENSMUSG00000061210
Gene Nameolfactory receptor 47
SynonymsGA_x6K02T2P3E9-4322325-4321360, IB12, MOR261-9
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R7600 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location43231529-43236959 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 43235836 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 76 (T76K)
Ref Sequence ENSEMBL: ENSMUSP00000151056 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078057] [ENSMUST00000215569]
Predicted Effect probably damaging
Transcript: ENSMUST00000078057
AA Change: T76K

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000077204
Gene: ENSMUSG00000061210
AA Change: T76K

DomainStartEndE-ValueType
Pfam:7tm_4 30 307 2.3e-62 PFAM
Pfam:7tm_1 40 289 4.6e-30 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000215569
AA Change: T76K

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (45/45)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam25 G A 8: 40,755,817 V707I probably benign Het
AF067063 A T 13: 119,828,696 probably null Het
Ahnak A T 19: 9,004,574 D1074V possibly damaging Het
Aldh4a1 A G 4: 139,645,004 M495V probably benign Het
Atxn1 T G 13: 45,557,060 K799Q possibly damaging Het
Catsperg2 A T 7: 29,704,858 S831T probably benign Het
Cldn1 T C 16: 26,360,919 T133A probably benign Het
Clec12b A G 6: 129,376,263 C254R probably damaging Het
Cnnm2 A T 19: 46,762,067 T99S probably benign Het
Col6a4 T G 9: 106,066,999 D1092A possibly damaging Het
Dnajc9 A G 14: 20,388,725 L20P probably damaging Het
Dsp C A 13: 38,191,715 Q1159K probably damaging Het
Dst C T 1: 34,266,930 T4110I probably damaging Het
Epb42 A G 2: 121,021,826 L562P probably damaging Het
Fras1 T C 5: 96,684,436 Y1543H probably damaging Het
Igkv1-117 T A 6: 68,121,116 V9E possibly damaging Het
Kbtbd8 T A 6: 95,122,592 Y361N probably damaging Het
Lrp1 C T 10: 127,555,706 R2948H probably benign Het
Lrp10 G T 14: 54,469,395 R563L possibly damaging Het
Mllt3 G T 4: 87,841,219 H197Q probably benign Het
Myo18b G A 5: 112,878,103 P27L unknown Het
Nlrp1a C A 11: 71,098,914 R1110L probably damaging Het
Nol10 T G 12: 17,369,480 D257E probably damaging Het
Olfm3 T C 3: 115,096,940 V114A possibly damaging Het
Olfr224 T C 11: 58,567,336 N3S probably benign Het
Pdzd2 G T 15: 12,372,734 D2438E probably damaging Het
Prl7a2 T G 13: 27,659,281 I180L possibly damaging Het
Ptch2 A T 4: 117,096,225 probably benign Het
Snrpn A G 7: 59,988,603 M1T probably null Het
Sntb1 A T 15: 55,792,188 W211R possibly damaging Het
Sp110 G A 1: 85,579,092 R417C Het
Sytl2 T C 7: 90,376,144 S447P probably benign Het
Tas2r129 G T 6: 132,951,174 G25* probably null Het
Tle2 T G 10: 81,586,313 Y396* probably null Het
Trpm2 T C 10: 77,938,051 K510R probably benign Het
Trpm3 A G 19: 22,926,094 T1073A possibly damaging Het
Ttc24 A T 3: 88,072,013 M1K probably null Het
Tubgcp5 A G 7: 55,808,513 T391A probably benign Het
Vmn1r17 T C 6: 57,360,921 E153G probably benign Het
Vmn1r232 A T 17: 20,913,737 N200K possibly damaging Het
Zcwpw1 A T 5: 137,800,134 K198* probably null Het
Zfp142 A G 1: 74,573,668 V641A probably damaging Het
Zfp318 C T 17: 46,384,284 A149V possibly damaging Het
Zfp608 T C 18: 54,988,020 N165S probably damaging Het
Other mutations in Olfr47
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01462:Olfr47 APN 6 43235625 missense possibly damaging 0.86
IGL03277:Olfr47 APN 6 43235942 missense probably damaging 1.00
R1334:Olfr47 UTSW 6 43235965 missense probably benign 0.44
R2697:Olfr47 UTSW 6 43236126 missense probably damaging 0.98
R3433:Olfr47 UTSW 6 43235673 missense probably damaging 0.96
R4794:Olfr47 UTSW 6 43235695 missense probably damaging 1.00
R4954:Olfr47 UTSW 6 43236384 missense probably benign 0.02
R4993:Olfr47 UTSW 6 43236456 missense possibly damaging 0.49
R6248:Olfr47 UTSW 6 43235904 nonsense probably null
R7464:Olfr47 UTSW 6 43236294 missense probably damaging 0.98
R7984:Olfr47 UTSW 6 43235796 missense probably damaging 1.00
R8189:Olfr47 UTSW 6 43236079 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TCACAGAGTTCATCCTGCTGG -3'
(R):5'- GTACACACTCTCCAGTTCATGATG -3'

Sequencing Primer
(F):5'- ATTCTGTCTTGGCCCGAGGATTC -3'
(R):5'- ACACTCTCCAGTTCATGATGACAGTG -3'
Posted On2019-10-24