Incidental Mutation 'R7600:Clec12b'
ID587964
Institutional Source Beutler Lab
Gene Symbol Clec12b
Ensembl Gene ENSMUSG00000030158
Gene NameC-type lectin domain family 12, member B
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.052) question?
Stock #R7600 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location129375515-129385874 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 129376263 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 254 (C254R)
Ref Sequence ENSEMBL: ENSMUSP00000032261 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032261] [ENSMUST00000112082]
Predicted Effect probably damaging
Transcript: ENSMUST00000032261
AA Change: C254R

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000032261
Gene: ENSMUSG00000030158
AA Change: C254R

DomainStartEndE-ValueType
low complexity region 46 60 N/A INTRINSIC
CLECT 142 263 6.62e-25 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112082
AA Change: C254R

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000107713
Gene: ENSMUSG00000030158
AA Change: C254R

DomainStartEndE-ValueType
low complexity region 46 60 N/A INTRINSIC
CLECT 142 263 6.62e-25 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (45/45)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam25 G A 8: 40,755,817 V707I probably benign Het
AF067063 A T 13: 119,828,696 probably null Het
Ahnak A T 19: 9,004,574 D1074V possibly damaging Het
Aldh4a1 A G 4: 139,645,004 M495V probably benign Het
Atxn1 T G 13: 45,557,060 K799Q possibly damaging Het
Catsperg2 A T 7: 29,704,858 S831T probably benign Het
Cldn1 T C 16: 26,360,919 T133A probably benign Het
Cnnm2 A T 19: 46,762,067 T99S probably benign Het
Col6a4 T G 9: 106,066,999 D1092A possibly damaging Het
Dnajc9 A G 14: 20,388,725 L20P probably damaging Het
Dsp C A 13: 38,191,715 Q1159K probably damaging Het
Dst C T 1: 34,266,930 T4110I probably damaging Het
Epb42 A G 2: 121,021,826 L562P probably damaging Het
Fras1 T C 5: 96,684,436 Y1543H probably damaging Het
Igkv1-117 T A 6: 68,121,116 V9E possibly damaging Het
Kbtbd8 T A 6: 95,122,592 Y361N probably damaging Het
Lrp1 C T 10: 127,555,706 R2948H probably benign Het
Lrp10 G T 14: 54,469,395 R563L possibly damaging Het
Mllt3 G T 4: 87,841,219 H197Q probably benign Het
Myo18b G A 5: 112,878,103 P27L unknown Het
Nlrp1a C A 11: 71,098,914 R1110L probably damaging Het
Nol10 T G 12: 17,369,480 D257E probably damaging Het
Olfm3 T C 3: 115,096,940 V114A possibly damaging Het
Olfr224 T C 11: 58,567,336 N3S probably benign Het
Olfr47 C A 6: 43,235,836 T76K probably damaging Het
Pdzd2 G T 15: 12,372,734 D2438E probably damaging Het
Prl7a2 T G 13: 27,659,281 I180L possibly damaging Het
Ptch2 A T 4: 117,096,225 probably benign Het
Snrpn A G 7: 59,988,603 M1T probably null Het
Sntb1 A T 15: 55,792,188 W211R possibly damaging Het
Sp110 G A 1: 85,579,092 R417C Het
Sytl2 T C 7: 90,376,144 S447P probably benign Het
Tas2r129 G T 6: 132,951,174 G25* probably null Het
Tle2 T G 10: 81,586,313 Y396* probably null Het
Trpm2 T C 10: 77,938,051 K510R probably benign Het
Trpm3 A G 19: 22,926,094 T1073A possibly damaging Het
Ttc24 A T 3: 88,072,013 M1K probably null Het
Tubgcp5 A G 7: 55,808,513 T391A probably benign Het
Vmn1r17 T C 6: 57,360,921 E153G probably benign Het
Vmn1r232 A T 17: 20,913,737 N200K possibly damaging Het
Zcwpw1 A T 5: 137,800,134 K198* probably null Het
Zfp142 A G 1: 74,573,668 V641A probably damaging Het
Zfp318 C T 17: 46,384,284 A149V possibly damaging Het
Zfp608 T C 18: 54,988,020 N165S probably damaging Het
Other mutations in Clec12b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01014:Clec12b APN 6 129385430 missense probably damaging 0.98
IGL01328:Clec12b APN 6 129379554 missense probably damaging 1.00
IGL01985:Clec12b APN 6 129382371 splice site probably benign
IGL03101:Clec12b APN 6 129379517 splice site probably null
R0662:Clec12b UTSW 6 129376237 missense probably damaging 1.00
R0786:Clec12b UTSW 6 129380688 missense probably benign 0.07
R1468:Clec12b UTSW 6 129380640 missense probably damaging 0.98
R1468:Clec12b UTSW 6 129380640 missense probably damaging 0.98
R1513:Clec12b UTSW 6 129376302 missense probably damaging 1.00
R4757:Clec12b UTSW 6 129380692 missense probably damaging 1.00
R5566:Clec12b UTSW 6 129385475 missense probably damaging 0.99
R5643:Clec12b UTSW 6 129379960 missense probably benign
R5644:Clec12b UTSW 6 129379960 missense probably benign
R7351:Clec12b UTSW 6 129379911 critical splice donor site probably null
R8347:Clec12b UTSW 6 129380487 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AGAAGCAGGTTTGTCCGTGC -3'
(R):5'- CCTGCTGCTTTGTAGAGGATGC -3'

Sequencing Primer
(F):5'- AAGCAGGTTTGTCCGTGCAATAG -3'
(R):5'- AGAGTCGGATTTTTCCCTCTAAAGG -3'
Posted On2019-10-24