Incidental Mutation 'R7600:Tas2r129'
ID587965
Institutional Source Beutler Lab
Gene Symbol Tas2r129
Ensembl Gene ENSMUSG00000063762
Gene Nametaste receptor, type 2, member 129
SynonymsTas2r29, mt2r60, T2R29, mGR29
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R7600 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location132951102-132952066 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 132951174 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Stop codon at position 25 (G25*)
Ref Sequence ENSEMBL: ENSMUSP00000067640 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070991]
Predicted Effect probably null
Transcript: ENSMUST00000070991
AA Change: G25*
SMART Domains Protein: ENSMUSP00000067640
Gene: ENSMUSG00000063762
AA Change: G25*

DomainStartEndE-ValueType
Pfam:TAS2R 1 302 2.3e-74 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (45/45)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam25 G A 8: 40,755,817 V707I probably benign Het
AF067063 A T 13: 119,828,696 probably null Het
Ahnak A T 19: 9,004,574 D1074V possibly damaging Het
Aldh4a1 A G 4: 139,645,004 M495V probably benign Het
Atxn1 T G 13: 45,557,060 K799Q possibly damaging Het
Catsperg2 A T 7: 29,704,858 S831T probably benign Het
Cldn1 T C 16: 26,360,919 T133A probably benign Het
Clec12b A G 6: 129,376,263 C254R probably damaging Het
Cnnm2 A T 19: 46,762,067 T99S probably benign Het
Col6a4 T G 9: 106,066,999 D1092A possibly damaging Het
Dnajc9 A G 14: 20,388,725 L20P probably damaging Het
Dsp C A 13: 38,191,715 Q1159K probably damaging Het
Dst C T 1: 34,266,930 T4110I probably damaging Het
Epb42 A G 2: 121,021,826 L562P probably damaging Het
Fras1 T C 5: 96,684,436 Y1543H probably damaging Het
Igkv1-117 T A 6: 68,121,116 V9E possibly damaging Het
Kbtbd8 T A 6: 95,122,592 Y361N probably damaging Het
Lrp1 C T 10: 127,555,706 R2948H probably benign Het
Lrp10 G T 14: 54,469,395 R563L possibly damaging Het
Mllt3 G T 4: 87,841,219 H197Q probably benign Het
Myo18b G A 5: 112,878,103 P27L unknown Het
Nlrp1a C A 11: 71,098,914 R1110L probably damaging Het
Nol10 T G 12: 17,369,480 D257E probably damaging Het
Olfm3 T C 3: 115,096,940 V114A possibly damaging Het
Olfr224 T C 11: 58,567,336 N3S probably benign Het
Olfr47 C A 6: 43,235,836 T76K probably damaging Het
Pdzd2 G T 15: 12,372,734 D2438E probably damaging Het
Prl7a2 T G 13: 27,659,281 I180L possibly damaging Het
Ptch2 A T 4: 117,096,225 probably benign Het
Snrpn A G 7: 59,988,603 M1T probably null Het
Sntb1 A T 15: 55,792,188 W211R possibly damaging Het
Sp110 G A 1: 85,579,092 R417C Het
Sytl2 T C 7: 90,376,144 S447P probably benign Het
Tle2 T G 10: 81,586,313 Y396* probably null Het
Trpm2 T C 10: 77,938,051 K510R probably benign Het
Trpm3 A G 19: 22,926,094 T1073A possibly damaging Het
Ttc24 A T 3: 88,072,013 M1K probably null Het
Tubgcp5 A G 7: 55,808,513 T391A probably benign Het
Vmn1r17 T C 6: 57,360,921 E153G probably benign Het
Vmn1r232 A T 17: 20,913,737 N200K possibly damaging Het
Zcwpw1 A T 5: 137,800,134 K198* probably null Het
Zfp142 A G 1: 74,573,668 V641A probably damaging Het
Zfp318 C T 17: 46,384,284 A149V possibly damaging Het
Zfp608 T C 18: 54,988,020 N165S probably damaging Het
Other mutations in Tas2r129
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02227:Tas2r129 APN 6 132951394 nonsense probably null
R0389:Tas2r129 UTSW 6 132951196 missense probably benign 0.26
R0443:Tas2r129 UTSW 6 132951196 missense probably benign 0.26
R0487:Tas2r129 UTSW 6 132951943 missense probably benign 0.26
R0487:Tas2r129 UTSW 6 132951944 missense probably benign 0.31
R0576:Tas2r129 UTSW 6 132951534 missense probably benign 0.38
R1253:Tas2r129 UTSW 6 132952036 missense probably benign 0.11
R3124:Tas2r129 UTSW 6 132951448 missense probably damaging 1.00
R4493:Tas2r129 UTSW 6 132951354 missense probably benign 0.31
R4494:Tas2r129 UTSW 6 132951354 missense probably benign 0.31
R4591:Tas2r129 UTSW 6 132951611 missense probably benign 0.10
R6156:Tas2r129 UTSW 6 132951492 missense probably benign 0.31
R6495:Tas2r129 UTSW 6 132951165 missense probably benign 0.00
R7608:Tas2r129 UTSW 6 132951193 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CTCAAATATTCTCCACACCACTTGG -3'
(R):5'- ACTCTTCTAGTTACCAACACGTG -3'

Sequencing Primer
(F):5'- TCGCTCTCACAGAAAAAGAGATATG -3'
(R):5'- CACGTGTGTGTATAGCGTAGAC -3'
Posted On2019-10-24