Incidental Mutation 'R7600:Snrpn'
ID587968
Institutional Source Beutler Lab
Gene Symbol Snrpn
Ensembl Gene ENSMUSG00000102252
Gene Namesmall nuclear ribonucleoprotein N
Synonyms2410045I01Rik, Peg4, Pwcr1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.133) question?
Stock #R7600 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location59982495-60140219 bp(-) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) A to G at 59988603 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 1 (M1T)
Ref Sequence ENSEMBL: ENSMUSP00000055941 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059305] [ENSMUST00000098402] [ENSMUST00000179360] [ENSMUST00000189432]
Predicted Effect probably null
Transcript: ENSMUST00000059305
AA Change: M1T

PolyPhen 2 Score 0.608 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000055941
Gene: ENSMUSG00000102252
AA Change: M1T

DomainStartEndE-ValueType
Sm 7 82 9.25e-25 SMART
low complexity region 93 119 N/A INTRINSIC
low complexity region 148 164 N/A INTRINSIC
low complexity region 169 209 N/A INTRINSIC
low complexity region 212 240 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000098402
AA Change: M1T

PolyPhen 2 Score 0.608 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000096003
Gene: ENSMUSG00000102252
AA Change: M1T

DomainStartEndE-ValueType
Sm 7 82 9.25e-25 SMART
low complexity region 93 119 N/A INTRINSIC
low complexity region 148 164 N/A INTRINSIC
low complexity region 169 209 N/A INTRINSIC
low complexity region 212 240 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000179360
SMART Domains Protein: ENSMUSP00000136053
Gene: ENSMUSG00000000948

DomainStartEndE-ValueType
Pfam:SNURF 1 70 4.4e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000189432
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (45/45)
MGI Phenotype FUNCTION: The protein encoded by this gene is one polypeptide of a small nuclear ribonucleoprotein complex, and it plays a role in pre-mRNA processing. Although individual snRNPs are believed to recognize specific nucleic acid sequences through RNA-RNA base pairing, the specific role of this family member is unknown. This protein arises from a bicistronic transcript that also encodes a protein identified as the Snrpn upstream reading frame (Snurf). Multiple transcription initiation sites have been identified and extensive alternative splicing occurs in the 5' untranslated region. Additional splice variants have been described but sequences for the complete transcripts have not been determined. The 5' UTR of this gene has been identified as an imprinting center. Alternative splicing or deletion caused by a translocation event in this paternally-expressed region in human and mouse is responsible for Angelman syndrome or Prader-Willi syndrome due to parental imprint switch failure. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted intragenic deletions are phenotypically normal. Deletions that also encompass neighboring genes on the paternal chromosome exhibit growth retardation, hypotonia, and high mortality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam25 G A 8: 40,755,817 V707I probably benign Het
AF067063 A T 13: 119,828,696 probably null Het
Ahnak A T 19: 9,004,574 D1074V possibly damaging Het
Aldh4a1 A G 4: 139,645,004 M495V probably benign Het
Atxn1 T G 13: 45,557,060 K799Q possibly damaging Het
Catsperg2 A T 7: 29,704,858 S831T probably benign Het
Cldn1 T C 16: 26,360,919 T133A probably benign Het
Clec12b A G 6: 129,376,263 C254R probably damaging Het
Cnnm2 A T 19: 46,762,067 T99S probably benign Het
Col6a4 T G 9: 106,066,999 D1092A possibly damaging Het
Dnajc9 A G 14: 20,388,725 L20P probably damaging Het
Dsp C A 13: 38,191,715 Q1159K probably damaging Het
Dst C T 1: 34,266,930 T4110I probably damaging Het
Epb42 A G 2: 121,021,826 L562P probably damaging Het
Fras1 T C 5: 96,684,436 Y1543H probably damaging Het
Igkv1-117 T A 6: 68,121,116 V9E possibly damaging Het
Kbtbd8 T A 6: 95,122,592 Y361N probably damaging Het
Lrp1 C T 10: 127,555,706 R2948H probably benign Het
Lrp10 G T 14: 54,469,395 R563L possibly damaging Het
Mllt3 G T 4: 87,841,219 H197Q probably benign Het
Myo18b G A 5: 112,878,103 P27L unknown Het
Nlrp1a C A 11: 71,098,914 R1110L probably damaging Het
Nol10 T G 12: 17,369,480 D257E probably damaging Het
Olfm3 T C 3: 115,096,940 V114A possibly damaging Het
Olfr224 T C 11: 58,567,336 N3S probably benign Het
Olfr47 C A 6: 43,235,836 T76K probably damaging Het
Pdzd2 G T 15: 12,372,734 D2438E probably damaging Het
Prl7a2 T G 13: 27,659,281 I180L possibly damaging Het
Ptch2 A T 4: 117,096,225 probably benign Het
Sntb1 A T 15: 55,792,188 W211R possibly damaging Het
Sp110 G A 1: 85,579,092 R417C Het
Sytl2 T C 7: 90,376,144 S447P probably benign Het
Tas2r129 G T 6: 132,951,174 G25* probably null Het
Tle2 T G 10: 81,586,313 Y396* probably null Het
Trpm2 T C 10: 77,938,051 K510R probably benign Het
Trpm3 A G 19: 22,926,094 T1073A possibly damaging Het
Ttc24 A T 3: 88,072,013 M1K probably null Het
Tubgcp5 A G 7: 55,808,513 T391A probably benign Het
Vmn1r17 T C 6: 57,360,921 E153G probably benign Het
Vmn1r232 A T 17: 20,913,737 N200K possibly damaging Het
Zcwpw1 A T 5: 137,800,134 K198* probably null Het
Zfp142 A G 1: 74,573,668 V641A probably damaging Het
Zfp318 C T 17: 46,384,284 A149V possibly damaging Het
Zfp608 T C 18: 54,988,020 N165S probably damaging Het
Other mutations in Snrpn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02081:Snrpn APN 7 59987446 missense possibly damaging 0.80
IGL03349:Snrpn APN 7 59985865 missense probably damaging 0.99
R0032:Snrpn UTSW 7 59985082 missense probably damaging 0.99
R1789:Snrpn UTSW 7 59983459 utr 3 prime probably benign
R2057:Snrpn UTSW 7 59987456 missense possibly damaging 0.95
R4621:Snrpn UTSW 7 59987526 missense possibly damaging 0.84
R7664:Snrpn UTSW 7 59987491 missense probably benign 0.15
R8183:Snrpn UTSW 7 59985082 missense probably damaging 0.99
R8250:Snrpn UTSW 7 59986885 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- AGCATAGGCCATCTCTTGATTGC -3'
(R):5'- TTGGACGCGCAATCAGTCTC -3'

Sequencing Primer
(F):5'- GGCCATCTCTTGATTGCTAAACAG -3'
(R):5'- CGCGCAATCAGTCTCTAATATACTG -3'
Posted On2019-10-24