Incidental Mutation 'R7600:Lrp10'
ID587982
Institutional Source Beutler Lab
Gene Symbol Lrp10
Ensembl Gene ENSMUSG00000022175
Gene Namelow-density lipoprotein receptor-related protein 10
SynonymsLrp9
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7600 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location54464137-54471497 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 54469395 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 563 (R563L)
Ref Sequence ENSEMBL: ENSMUSP00000022782 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022782] [ENSMUST00000227760]
Predicted Effect possibly damaging
Transcript: ENSMUST00000022782
AA Change: R563L

PolyPhen 2 Score 0.932 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000022782
Gene: ENSMUSG00000022175
AA Change: R563L

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
CUB 29 137 5.33e-2 SMART
LDLa 140 177 5.26e-13 SMART
CUB 193 306 2.57e-4 SMART
LDLa 308 356 1.05e-3 SMART
LDLa 357 399 4.89e-2 SMART
LDLa 400 436 1.63e-9 SMART
transmembrane domain 442 464 N/A INTRINSIC
low complexity region 544 569 N/A INTRINSIC
low complexity region 614 629 N/A INTRINSIC
low complexity region 634 655 N/A INTRINSIC
low complexity region 672 681 N/A INTRINSIC
low complexity region 685 710 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000227760
Predicted Effect probably benign
Transcript: ENSMUST00000228407
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (45/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a low density lipoprotein receptor family protein. A similar protein in mouse is thought to play a role in the uptake of apolipoprotein E-containing lipoproteins. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam25 G A 8: 40,755,817 V707I probably benign Het
AF067063 A T 13: 119,828,696 probably null Het
Ahnak A T 19: 9,004,574 D1074V possibly damaging Het
Aldh4a1 A G 4: 139,645,004 M495V probably benign Het
Atxn1 T G 13: 45,557,060 K799Q possibly damaging Het
Catsperg2 A T 7: 29,704,858 S831T probably benign Het
Cldn1 T C 16: 26,360,919 T133A probably benign Het
Clec12b A G 6: 129,376,263 C254R probably damaging Het
Cnnm2 A T 19: 46,762,067 T99S probably benign Het
Col6a4 T G 9: 106,066,999 D1092A possibly damaging Het
Dnajc9 A G 14: 20,388,725 L20P probably damaging Het
Dsp C A 13: 38,191,715 Q1159K probably damaging Het
Dst C T 1: 34,266,930 T4110I probably damaging Het
Epb42 A G 2: 121,021,826 L562P probably damaging Het
Fras1 T C 5: 96,684,436 Y1543H probably damaging Het
Igkv1-117 T A 6: 68,121,116 V9E possibly damaging Het
Kbtbd8 T A 6: 95,122,592 Y361N probably damaging Het
Lrp1 C T 10: 127,555,706 R2948H probably benign Het
Mllt3 G T 4: 87,841,219 H197Q probably benign Het
Myo18b G A 5: 112,878,103 P27L unknown Het
Nlrp1a C A 11: 71,098,914 R1110L probably damaging Het
Nol10 T G 12: 17,369,480 D257E probably damaging Het
Olfm3 T C 3: 115,096,940 V114A possibly damaging Het
Olfr224 T C 11: 58,567,336 N3S probably benign Het
Olfr47 C A 6: 43,235,836 T76K probably damaging Het
Pdzd2 G T 15: 12,372,734 D2438E probably damaging Het
Prl7a2 T G 13: 27,659,281 I180L possibly damaging Het
Ptch2 A T 4: 117,096,225 probably benign Het
Snrpn A G 7: 59,988,603 M1T probably null Het
Sntb1 A T 15: 55,792,188 W211R possibly damaging Het
Sp110 G A 1: 85,579,092 R417C Het
Sytl2 T C 7: 90,376,144 S447P probably benign Het
Tas2r129 G T 6: 132,951,174 G25* probably null Het
Tle2 T G 10: 81,586,313 Y396* probably null Het
Trpm2 T C 10: 77,938,051 K510R probably benign Het
Trpm3 A G 19: 22,926,094 T1073A possibly damaging Het
Ttc24 A T 3: 88,072,013 M1K probably null Het
Tubgcp5 A G 7: 55,808,513 T391A probably benign Het
Vmn1r17 T C 6: 57,360,921 E153G probably benign Het
Vmn1r232 A T 17: 20,913,737 N200K possibly damaging Het
Zcwpw1 A T 5: 137,800,134 K198* probably null Het
Zfp142 A G 1: 74,573,668 V641A probably damaging Het
Zfp318 C T 17: 46,384,284 A149V possibly damaging Het
Zfp608 T C 18: 54,988,020 N165S probably damaging Het
Other mutations in Lrp10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01951:Lrp10 APN 14 54468662 nonsense probably null
IGL02641:Lrp10 APN 14 54468611 nonsense probably null
IGL02697:Lrp10 APN 14 54469697 missense probably damaging 1.00
IGL02974:Lrp10 APN 14 54467884 nonsense probably null
IGL03030:Lrp10 APN 14 54469162 missense possibly damaging 0.69
chowmein UTSW 14 54468090 missense probably damaging 1.00
egg_fu_young UTSW 14 54469266 missense possibly damaging 0.66
R0452:Lrp10 UTSW 14 54467579 missense probably benign 0.08
R0765:Lrp10 UTSW 14 54468090 missense probably damaging 1.00
R1700:Lrp10 UTSW 14 54469752 missense possibly damaging 0.94
R1726:Lrp10 UTSW 14 54469656 missense probably damaging 0.99
R2943:Lrp10 UTSW 14 54469845 unclassified probably benign
R3746:Lrp10 UTSW 14 54469266 missense possibly damaging 0.66
R3749:Lrp10 UTSW 14 54469266 missense possibly damaging 0.66
R4356:Lrp10 UTSW 14 54468366 missense probably damaging 0.98
R4357:Lrp10 UTSW 14 54468366 missense probably damaging 0.98
R4358:Lrp10 UTSW 14 54468366 missense probably damaging 0.98
R4379:Lrp10 UTSW 14 54468366 missense probably damaging 0.98
R4380:Lrp10 UTSW 14 54468366 missense probably damaging 0.98
R4751:Lrp10 UTSW 14 54468592 missense probably damaging 1.00
R5055:Lrp10 UTSW 14 54468345 missense probably benign 0.00
R5133:Lrp10 UTSW 14 54469610 missense probably benign
R6633:Lrp10 UTSW 14 54469074 missense probably benign 0.03
R6845:Lrp10 UTSW 14 54469688 missense probably damaging 1.00
R6874:Lrp10 UTSW 14 54468213 missense possibly damaging 0.50
R6958:Lrp10 UTSW 14 54469821 unclassified probably benign
R6989:Lrp10 UTSW 14 54468493 missense probably benign 0.30
R7162:Lrp10 UTSW 14 54465706 missense possibly damaging 0.60
R7453:Lrp10 UTSW 14 54468456 missense probably damaging 1.00
X0026:Lrp10 UTSW 14 54469399 nonsense probably null
X0027:Lrp10 UTSW 14 54468535 missense probably damaging 1.00
Z1088:Lrp10 UTSW 14 54467922 missense probably benign 0.01
Z1177:Lrp10 UTSW 14 54467561 missense possibly damaging 0.75
Predicted Primers PCR Primer
(F):5'- ATCTGGCCACCCTGATTCTG -3'
(R):5'- CAACAGTGATGATTCTACAGGC -3'

Sequencing Primer
(F):5'- ACCCTGATTCTGACGTCTGC -3'
(R):5'- CTCAGAGACAGTAGCAAGGGC -3'
Posted On2019-10-24