Incidental Mutation 'R7600:Cldn1'
ID587985
Institutional Source Beutler Lab
Gene Symbol Cldn1
Ensembl Gene ENSMUSG00000022512
Gene Nameclaudin 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7600 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location26356642-26371841 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 26360919 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 133 (T133A)
Ref Sequence ENSEMBL: ENSMUSP00000023154 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023154]
Predicted Effect probably benign
Transcript: ENSMUST00000023154
AA Change: T133A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000023154
Gene: ENSMUSG00000022512
AA Change: T133A

DomainStartEndE-ValueType
Pfam:PMP22_Claudin 4 182 2e-54 PFAM
Pfam:Claudin_2 15 184 4.4e-10 PFAM
low complexity region 187 205 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (45/45)
MGI Phenotype FUNCTION: This gene encodes a member of the claudin family. Claudins are integral membrane proteins and components of tight junction strands. Tight junction strands serve as a physical barrier to prevent solutes and water from passing freely through the paracellular space between epithelial or endothelial cell sheets, and also play critical roles in maintaining cell polarity and signal transductions. The knockout mice lacking this gene die soon after birth as a consequence of dehydration from trandermal water loss, indicating that this gene is indispensable for creating and maintaining the epidermal barrier. The protein encoded by this gene also has gastric tumor suppressive activity, and is a key factor for hepatitis C virus (HCV) entry. [provided by RefSeq, Aug 2010]
PHENOTYPE: Animals homozygous for a mutation in this gene have wrinkled skin and die within 1 day after birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam25 G A 8: 40,755,817 V707I probably benign Het
AF067063 A T 13: 119,828,696 probably null Het
Ahnak A T 19: 9,004,574 D1074V possibly damaging Het
Aldh4a1 A G 4: 139,645,004 M495V probably benign Het
Atxn1 T G 13: 45,557,060 K799Q possibly damaging Het
Catsperg2 A T 7: 29,704,858 S831T probably benign Het
Clec12b A G 6: 129,376,263 C254R probably damaging Het
Cnnm2 A T 19: 46,762,067 T99S probably benign Het
Col6a4 T G 9: 106,066,999 D1092A possibly damaging Het
Dnajc9 A G 14: 20,388,725 L20P probably damaging Het
Dsp C A 13: 38,191,715 Q1159K probably damaging Het
Dst C T 1: 34,266,930 T4110I probably damaging Het
Epb42 A G 2: 121,021,826 L562P probably damaging Het
Fras1 T C 5: 96,684,436 Y1543H probably damaging Het
Igkv1-117 T A 6: 68,121,116 V9E possibly damaging Het
Kbtbd8 T A 6: 95,122,592 Y361N probably damaging Het
Lrp1 C T 10: 127,555,706 R2948H probably benign Het
Lrp10 G T 14: 54,469,395 R563L possibly damaging Het
Mllt3 G T 4: 87,841,219 H197Q probably benign Het
Myo18b G A 5: 112,878,103 P27L unknown Het
Nlrp1a C A 11: 71,098,914 R1110L probably damaging Het
Nol10 T G 12: 17,369,480 D257E probably damaging Het
Olfm3 T C 3: 115,096,940 V114A possibly damaging Het
Olfr224 T C 11: 58,567,336 N3S probably benign Het
Olfr47 C A 6: 43,235,836 T76K probably damaging Het
Pdzd2 G T 15: 12,372,734 D2438E probably damaging Het
Prl7a2 T G 13: 27,659,281 I180L possibly damaging Het
Ptch2 A T 4: 117,096,225 probably benign Het
Snrpn A G 7: 59,988,603 M1T probably null Het
Sntb1 A T 15: 55,792,188 W211R possibly damaging Het
Sp110 G A 1: 85,579,092 R417C Het
Sytl2 T C 7: 90,376,144 S447P probably benign Het
Tas2r129 G T 6: 132,951,174 G25* probably null Het
Tle2 T G 10: 81,586,313 Y396* probably null Het
Trpm2 T C 10: 77,938,051 K510R probably benign Het
Trpm3 A G 19: 22,926,094 T1073A possibly damaging Het
Ttc24 A T 3: 88,072,013 M1K probably null Het
Tubgcp5 A G 7: 55,808,513 T391A probably benign Het
Vmn1r17 T C 6: 57,360,921 E153G probably benign Het
Vmn1r232 A T 17: 20,913,737 N200K possibly damaging Het
Zcwpw1 A T 5: 137,800,134 K198* probably null Het
Zfp142 A G 1: 74,573,668 V641A probably damaging Het
Zfp318 C T 17: 46,384,284 A149V possibly damaging Het
Zfp608 T C 18: 54,988,020 N165S probably damaging Het
Other mutations in Cldn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01471:Cldn1 APN 16 26371572 missense possibly damaging 0.59
IGL02937:Cldn1 APN 16 26360873 missense probably damaging 1.00
R1626:Cldn1 UTSW 16 26371452 missense probably damaging 1.00
R2131:Cldn1 UTSW 16 26371550 missense probably damaging 0.98
R2264:Cldn1 UTSW 16 26359199 missense probably damaging 1.00
R3778:Cldn1 UTSW 16 26371466 missense probably damaging 1.00
R4850:Cldn1 UTSW 16 26363163 missense probably benign 0.04
R5711:Cldn1 UTSW 16 26371417 missense probably damaging 1.00
R5753:Cldn1 UTSW 16 26363121 missense probably benign 0.01
R6017:Cldn1 UTSW 16 26363219 missense probably damaging 1.00
R7134:Cldn1 UTSW 16 26371626 start codon destroyed probably null 0.98
R7199:Cldn1 UTSW 16 26371596 missense probably benign 0.06
R7373:Cldn1 UTSW 16 26360856 missense probably damaging 1.00
R7675:Cldn1 UTSW 16 26371511 missense probably benign 0.00
Z1177:Cldn1 UTSW 16 26360864 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGCAAGTGTGACATGAATTTCC -3'
(R):5'- TAATTCCTTGCAGAACGGTTGG -3'

Sequencing Primer
(F):5'- CCATACAATTCTTGAAAGCAAATCTG -3'
(R):5'- CTTGCAGAACGGTTGGCATAAATC -3'
Posted On2019-10-24