Incidental Mutation 'R7601:Sp110'
ID 587993
Institutional Source Beutler Lab
Gene Symbol Sp110
Ensembl Gene ENSMUSG00000070034
Gene Name Sp110 nuclear body protein
Synonyms Ifi75, 5830484A20Rik, 5031415C07Rik, Ipr1, 52kDa
MMRRC Submission 045643-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.572) question?
Stock # R7601 (G1)
Quality Score 209.009
Status Not validated
Chromosome 1
Chromosomal Location 85504620-85526538 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 85506813 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Cysteine at position 417 (R417C)
Ref Sequence ENSEMBL: ENSMUSP00000091226 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093508] [ENSMUST00000178024]
AlphaFold Q8BVK9
PDB Structure Solution structure of the SAND domain of the putative nuclear protein homolog (5830484A20Rik) [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000093508
AA Change: R417C

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000091226
Gene: ENSMUSG00000070034
AA Change: R417C

DomainStartEndE-ValueType
Pfam:Sp100 8 106 2.3e-41 PFAM
low complexity region 242 254 N/A INTRINSIC
low complexity region 259 269 N/A INTRINSIC
SAND 360 433 3.55e-28 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000178024
SMART Domains Protein: ENSMUSP00000136816
Gene: ENSMUSG00000094127

DomainStartEndE-ValueType
low complexity region 1 10 N/A INTRINSIC
low complexity region 82 122 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 98% (40/41)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310061I04Rik A G 17: 36,206,741 (GRCm39) L16P probably damaging Het
Abcc5 A T 16: 20,193,882 (GRCm39) Y746* probably null Het
Abcd4 A G 12: 84,660,719 (GRCm39) Y129H possibly damaging Het
Acot10 T C 15: 20,665,715 (GRCm39) D342G probably damaging Het
Als2 G T 1: 59,209,161 (GRCm39) T1466K probably benign Het
Calcr A T 6: 3,687,603 (GRCm39) I465N probably benign Het
Ccndbp1 T C 2: 120,846,627 (GRCm39) S309P probably damaging Het
Cdh22 A G 2: 164,954,466 (GRCm39) L685P probably damaging Het
Cenps A G 4: 149,216,772 (GRCm39) V39A possibly damaging Het
Dbr1 G T 9: 99,464,655 (GRCm39) E145* probably null Het
Dync1i1 T A 6: 5,905,129 (GRCm39) V161E probably benign Het
Eeig2 T A 3: 108,895,628 (GRCm39) T151S possibly damaging Het
F10 A G 8: 13,100,781 (GRCm39) T232A probably benign Het
Faim2 C T 15: 99,398,147 (GRCm39) G279D probably damaging Het
Fam114a2 T C 11: 57,405,042 (GRCm39) K20R possibly damaging Het
Hspa4l T C 3: 40,738,788 (GRCm39) probably null Het
Impg2 A T 16: 56,080,394 (GRCm39) I733L probably benign Het
Itga11 T C 9: 62,604,208 (GRCm39) V32A probably benign Het
Lima1 G A 15: 99,717,577 (GRCm39) P143L probably benign Het
Lum A T 10: 97,404,168 (GRCm39) Y21F probably damaging Het
Muc6 A G 7: 141,216,454 (GRCm39) S2740P unknown Het
Nav1 A T 1: 135,388,176 (GRCm39) D1082E unknown Het
Nmur1 A C 1: 86,315,741 (GRCm39) C41W probably damaging Het
Or10ad1c G A 15: 98,084,860 (GRCm39) H273Y probably damaging Het
Or4k37 T C 2: 111,159,565 (GRCm39) V267A probably benign Het
Or5k3 A G 16: 58,969,597 (GRCm39) N128S probably benign Het
Or8b41 T C 9: 38,054,674 (GRCm39) V76A probably benign Het
Pdcd11 T C 19: 47,094,808 (GRCm39) S531P not run Het
Phtf1 T A 3: 103,901,161 (GRCm39) H403Q probably benign Het
Piezo1 C T 8: 123,210,220 (GRCm39) probably null Het
Pigh G A 12: 79,132,479 (GRCm39) T111I probably damaging Het
Plekhf1 T C 7: 37,921,304 (GRCm39) E88G probably damaging Het
Pnliprp1 C T 19: 58,720,526 (GRCm39) T134M probably damaging Het
Ptges T A 2: 30,782,809 (GRCm39) Y81F probably benign Het
Sema7a T C 9: 57,847,560 (GRCm39) S43P probably benign Het
Sephs2 A T 7: 126,872,118 (GRCm39) I325K probably damaging Het
Slc45a1 A T 4: 150,713,994 (GRCm39) N750K possibly damaging Het
Tbc1d23 A T 16: 57,001,897 (GRCm39) M519K probably benign Het
Trdn A G 10: 33,072,152 (GRCm39) E273G probably benign Het
Ubtf G A 11: 102,197,480 (GRCm39) S724F unknown Het
Was GCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTC GCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTC X: 7,952,450 (GRCm39) probably benign Het
Other mutations in Sp110
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00503:Sp110 APN 1 85,505,050 (GRCm39) missense probably benign
IGL00510:Sp110 APN 1 85,505,050 (GRCm39) missense probably benign
IGL00516:Sp110 APN 1 85,505,050 (GRCm39) missense probably benign
IGL00990:Sp110 APN 1 85,514,002 (GRCm39) missense possibly damaging 0.51
IGL03382:Sp110 APN 1 85,505,050 (GRCm39) missense probably benign
FR4342:Sp110 UTSW 1 85,515,209 (GRCm39) small insertion probably benign
FR4976:Sp110 UTSW 1 85,515,210 (GRCm39) small insertion probably benign
IGL03147:Sp110 UTSW 1 85,519,288 (GRCm39) frame shift probably null
PIT4131001:Sp110 UTSW 1 85,513,975 (GRCm39) missense probably benign 0.01
PIT4131001:Sp110 UTSW 1 85,513,971 (GRCm39) missense probably benign 0.05
PIT4142001:Sp110 UTSW 1 85,513,975 (GRCm39) missense probably benign 0.01
PIT4142001:Sp110 UTSW 1 85,513,971 (GRCm39) missense probably benign 0.05
R0472:Sp110 UTSW 1 85,516,841 (GRCm39) missense possibly damaging 0.79
R0483:Sp110 UTSW 1 85,516,839 (GRCm39) missense probably damaging 0.99
R0551:Sp110 UTSW 1 85,516,821 (GRCm39) splice site probably benign
R0638:Sp110 UTSW 1 85,505,050 (GRCm39) missense probably benign
R0806:Sp110 UTSW 1 85,514,002 (GRCm39) missense possibly damaging 0.51
R0806:Sp110 UTSW 1 85,513,975 (GRCm39) missense probably benign 0.01
R1074:Sp110 UTSW 1 85,516,839 (GRCm39) missense probably damaging 0.99
R1079:Sp110 UTSW 1 85,516,825 (GRCm39) splice site probably benign
R1228:Sp110 UTSW 1 85,519,481 (GRCm39) missense probably benign 0.03
R1403:Sp110 UTSW 1 85,506,800 (GRCm39) missense probably benign 0.00
R1406:Sp110 UTSW 1 85,506,800 (GRCm39) missense probably benign 0.00
R1418:Sp110 UTSW 1 85,522,106 (GRCm39) missense probably benign 0.08
R1718:Sp110 UTSW 1 85,522,106 (GRCm39) missense probably benign 0.08
R1744:Sp110 UTSW 1 85,522,093 (GRCm39) missense probably benign 0.26
R1747:Sp110 UTSW 1 85,516,839 (GRCm39) missense probably damaging 0.99
R1806:Sp110 UTSW 1 85,523,831 (GRCm39) critical splice acceptor site probably null
R1957:Sp110 UTSW 1 85,505,050 (GRCm39) missense probably benign
R2404:Sp110 UTSW 1 85,505,050 (GRCm39) missense probably benign
R2964:Sp110 UTSW 1 85,505,050 (GRCm39) missense probably benign
R3176:Sp110 UTSW 1 85,505,050 (GRCm39) missense probably benign
R4190:Sp110 UTSW 1 85,516,839 (GRCm39) missense probably damaging 0.99
R4398:Sp110 UTSW 1 85,505,050 (GRCm39) missense probably benign
R4505:Sp110 UTSW 1 85,516,894 (GRCm39) missense probably damaging 1.00
R4565:Sp110 UTSW 1 85,516,839 (GRCm39) missense probably damaging 0.99
R4625:Sp110 UTSW 1 85,505,050 (GRCm39) missense probably benign
R4922:Sp110 UTSW 1 85,516,839 (GRCm39) missense probably damaging 0.99
R4986:Sp110 UTSW 1 85,519,481 (GRCm39) missense probably benign 0.03
R5014:Sp110 UTSW 1 85,505,050 (GRCm39) missense probably benign
R5080:Sp110 UTSW 1 85,523,776 (GRCm39) nonsense probably null
R5087:Sp110 UTSW 1 85,516,839 (GRCm39) missense probably damaging 0.99
R5254:Sp110 UTSW 1 85,504,923 (GRCm39) utr 3 prime probably benign
R5335:Sp110 UTSW 1 85,516,839 (GRCm39) missense probably damaging 0.99
R5353:Sp110 UTSW 1 85,516,841 (GRCm39) missense possibly damaging 0.79
R5383:Sp110 UTSW 1 85,519,290 (GRCm39) frame shift probably null
R5387:Sp110 UTSW 1 85,516,839 (GRCm39) missense probably damaging 0.99
R5389:Sp110 UTSW 1 85,516,839 (GRCm39) missense probably damaging 0.99
R5398:Sp110 UTSW 1 85,516,839 (GRCm39) missense probably damaging 0.99
R5443:Sp110 UTSW 1 85,516,841 (GRCm39) missense possibly damaging 0.79
R5447:Sp110 UTSW 1 85,516,839 (GRCm39) missense probably damaging 0.99
R5729:Sp110 UTSW 1 85,516,839 (GRCm39) missense probably damaging 0.99
R5752:Sp110 UTSW 1 85,504,923 (GRCm39) utr 3 prime probably benign
R5754:Sp110 UTSW 1 85,504,923 (GRCm39) utr 3 prime probably benign
R5799:Sp110 UTSW 1 85,505,050 (GRCm39) missense probably benign
R6027:Sp110 UTSW 1 85,505,039 (GRCm39) missense possibly damaging 0.83
R6171:Sp110 UTSW 1 85,505,050 (GRCm39) missense probably benign
R6367:Sp110 UTSW 1 85,522,013 (GRCm39) missense probably benign 0.00
R6771:Sp110 UTSW 1 85,520,000 (GRCm39) splice site probably null
R7097:Sp110 UTSW 1 85,507,406 (GRCm39) missense possibly damaging 0.80
R7519:Sp110 UTSW 1 85,506,813 (GRCm39) missense probably benign 0.01
R7520:Sp110 UTSW 1 85,506,813 (GRCm39) missense probably benign 0.01
R7594:Sp110 UTSW 1 85,506,813 (GRCm39) missense probably benign 0.01
R7596:Sp110 UTSW 1 85,506,813 (GRCm39) missense probably benign 0.01
R7598:Sp110 UTSW 1 85,506,813 (GRCm39) missense probably benign 0.01
R7600:Sp110 UTSW 1 85,506,813 (GRCm39) missense probably benign 0.01
R7602:Sp110 UTSW 1 85,506,813 (GRCm39) missense probably benign 0.01
R7640:Sp110 UTSW 1 85,506,813 (GRCm39) missense probably benign 0.01
R7641:Sp110 UTSW 1 85,506,813 (GRCm39) missense probably benign 0.01
R7674:Sp110 UTSW 1 85,506,813 (GRCm39) missense probably benign 0.01
R7691:Sp110 UTSW 1 85,506,813 (GRCm39) missense probably benign 0.01
R7695:Sp110 UTSW 1 85,506,813 (GRCm39) missense probably benign 0.01
R8072:Sp110 UTSW 1 85,515,207 (GRCm39) small insertion probably benign
R8794:Sp110 UTSW 1 85,511,231 (GRCm39) critical splice donor site probably null
R9284:Sp110 UTSW 1 85,507,363 (GRCm39) critical splice donor site probably null
R9350:Sp110 UTSW 1 85,506,813 (GRCm39) missense probably benign 0.01
X0035:Sp110 UTSW 1 85,513,975 (GRCm39) missense probably benign 0.01
Predicted Primers
Posted On 2019-10-24