Incidental Mutation 'R7601:Sp110'
ID587993
Institutional Source Beutler Lab
Gene Symbol Sp110
Ensembl Gene ENSMUSG00000070034
Gene NameSp110 nuclear body protein
Synonyms5830484A20Rik, Ipr1, Ifi75, 5031415C07Rik, 52kDa
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.651) question?
Stock #R7601 (G1)
Quality Score209.009
Status Not validated
Chromosome1
Chromosomal Location85576899-85598817 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 85579092 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 417 (R417C)
Ref Sequence ENSEMBL: ENSMUSP00000091226 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093508]
PDB Structure
Solution structure of the SAND domain of the putative nuclear protein homolog (5830484A20Rik) [SOLUTION NMR]
Predicted Effect
SMART Domains Protein: ENSMUSP00000091226
Gene: ENSMUSG00000070034
AA Change: R417C

DomainStartEndE-ValueType
Pfam:Sp100 8 106 2.3e-41 PFAM
low complexity region 242 254 N/A INTRINSIC
low complexity region 259 269 N/A INTRINSIC
SAND 360 433 3.55e-28 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 98% (40/41)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310061I04Rik A G 17: 35,895,849 L16P probably damaging Het
Abcc5 A T 16: 20,375,132 Y746* probably null Het
Abcd4 A G 12: 84,613,945 Y129H possibly damaging Het
Acot10 T C 15: 20,665,629 D342G probably damaging Het
Als2 G T 1: 59,170,002 T1466K probably benign Het
Calcr A T 6: 3,687,603 I465N probably benign Het
Ccndbp1 T C 2: 121,016,146 S309P probably damaging Het
Cdh22 A G 2: 165,112,546 L685P probably damaging Het
Cenps A G 4: 149,132,315 V39A possibly damaging Het
Dbr1 G T 9: 99,582,602 E145* probably null Het
Dync1i1 T A 6: 5,905,129 V161E probably benign Het
F10 A G 8: 13,050,781 T232A probably benign Het
Faim2 C T 15: 99,500,266 G279D probably damaging Het
Fam102b T A 3: 108,988,312 T151S possibly damaging Het
Fam114a2 T C 11: 57,514,216 K20R possibly damaging Het
Hspa4l T C 3: 40,784,356 probably null Het
Impg2 A T 16: 56,260,031 I733L probably benign Het
Itga11 T C 9: 62,696,926 V32A probably benign Het
Lima1 G A 15: 99,819,696 P143L probably benign Het
Lum A T 10: 97,568,306 Y21F probably damaging Het
Muc6 A G 7: 141,636,541 S2740P unknown Het
Nav1 A T 1: 135,460,438 D1082E unknown Het
Nmur1 A C 1: 86,388,019 C41W probably damaging Het
Olfr1281 T C 2: 111,329,220 V267A probably benign Het
Olfr195 A G 16: 59,149,234 N128S probably benign Het
Olfr288 G A 15: 98,186,979 H273Y probably damaging Het
Olfr890 T C 9: 38,143,378 V76A probably benign Het
Pdcd11 T C 19: 47,106,369 S531P not run Het
Phtf1 T A 3: 103,993,845 H403Q probably benign Het
Piezo1 C T 8: 122,483,481 probably null Het
Pigh G A 12: 79,085,705 T111I probably damaging Het
Plekhf1 T C 7: 38,221,880 E88G probably damaging Het
Pnliprp1 C T 19: 58,732,094 T134M probably damaging Het
Ptges T A 2: 30,892,797 Y81F probably benign Het
Sema7a T C 9: 57,940,277 S43P probably benign Het
Sephs2 A T 7: 127,272,946 I325K probably damaging Het
Slc45a1 A T 4: 150,629,537 N750K possibly damaging Het
Tbc1d23 A T 16: 57,181,534 M519K probably benign Het
Trdn A G 10: 33,196,156 E273G probably benign Het
Ubtf G A 11: 102,306,654 S724F unknown Het
Was GCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTC GCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTC X: 8,086,211 probably benign Het
Other mutations in Sp110
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00503:Sp110 APN 1 85577329 missense probably benign
IGL00510:Sp110 APN 1 85577329 missense probably benign
IGL00516:Sp110 APN 1 85577329 missense probably benign
IGL00990:Sp110 APN 1 85586281 missense possibly damaging 0.51
IGL03382:Sp110 APN 1 85577329 missense probably benign
FR4342:Sp110 UTSW 1 85587488 small insertion probably benign
FR4976:Sp110 UTSW 1 85587489 small insertion probably benign
IGL03147:Sp110 UTSW 1 85591567 frame shift probably null
PIT4131001:Sp110 UTSW 1 85586250 missense probably benign 0.05
PIT4131001:Sp110 UTSW 1 85586254 missense probably benign 0.01
PIT4142001:Sp110 UTSW 1 85586250 missense probably benign 0.05
PIT4142001:Sp110 UTSW 1 85586254 missense probably benign 0.01
R0472:Sp110 UTSW 1 85589120 missense possibly damaging 0.79
R0483:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R0551:Sp110 UTSW 1 85589100 splice site probably benign
R0638:Sp110 UTSW 1 85577329 missense probably benign
R0806:Sp110 UTSW 1 85586254 missense probably benign 0.01
R0806:Sp110 UTSW 1 85586281 missense possibly damaging 0.51
R1074:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R1079:Sp110 UTSW 1 85589104 splice site probably benign
R1228:Sp110 UTSW 1 85591760 missense probably benign 0.03
R1403:Sp110 UTSW 1 85579079 missense probably benign 0.00
R1406:Sp110 UTSW 1 85579079 missense probably benign 0.00
R1418:Sp110 UTSW 1 85594385 missense probably benign 0.08
R1718:Sp110 UTSW 1 85594385 missense probably benign 0.08
R1744:Sp110 UTSW 1 85594372 missense probably benign 0.26
R1747:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R1806:Sp110 UTSW 1 85596110 critical splice acceptor site probably null
R1957:Sp110 UTSW 1 85577329 missense probably benign
R2404:Sp110 UTSW 1 85577329 missense probably benign
R2964:Sp110 UTSW 1 85577329 missense probably benign
R3176:Sp110 UTSW 1 85577329 missense probably benign
R4190:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R4398:Sp110 UTSW 1 85577329 missense probably benign
R4505:Sp110 UTSW 1 85589173 missense probably damaging 1.00
R4565:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R4625:Sp110 UTSW 1 85577329 missense probably benign
R4922:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R4986:Sp110 UTSW 1 85591760 missense probably benign 0.03
R5014:Sp110 UTSW 1 85577329 missense probably benign
R5080:Sp110 UTSW 1 85596055 nonsense probably null
R5087:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R5254:Sp110 UTSW 1 85577202 utr 3 prime probably benign
R5335:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R5353:Sp110 UTSW 1 85589120 missense possibly damaging 0.79
R5383:Sp110 UTSW 1 85591569 frame shift probably null
R5387:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R5389:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R5398:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R5443:Sp110 UTSW 1 85589120 missense possibly damaging 0.79
R5447:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R5729:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R5752:Sp110 UTSW 1 85577202 utr 3 prime probably benign
R5754:Sp110 UTSW 1 85577202 utr 3 prime probably benign
R5799:Sp110 UTSW 1 85577329 missense probably benign
R6027:Sp110 UTSW 1 85577318 missense possibly damaging 0.83
R6171:Sp110 UTSW 1 85577329 missense probably benign
R6367:Sp110 UTSW 1 85594292 missense probably benign 0.00
R6771:Sp110 UTSW 1 85592279 intron probably null
R7097:Sp110 UTSW 1 85579685 missense possibly damaging 0.80
R7519:Sp110 UTSW 1 85579092 missense
R7520:Sp110 UTSW 1 85579092 missense
R7594:Sp110 UTSW 1 85579092 missense
R7596:Sp110 UTSW 1 85579092 missense
R7598:Sp110 UTSW 1 85579092 missense
R7600:Sp110 UTSW 1 85579092 missense
R7602:Sp110 UTSW 1 85579092 missense
R7640:Sp110 UTSW 1 85579092 missense
R7641:Sp110 UTSW 1 85579092 missense
R7674:Sp110 UTSW 1 85579092 missense
R7691:Sp110 UTSW 1 85579092 missense
R7695:Sp110 UTSW 1 85579092 missense
R8072:Sp110 UTSW 1 85587486 small insertion probably benign
X0035:Sp110 UTSW 1 85586254 missense probably benign 0.01
Predicted Primers
Posted On2019-10-24