Incidental Mutation 'R7601:Nmur1'
ID587994
Institutional Source Beutler Lab
Gene Symbol Nmur1
Ensembl Gene ENSMUSG00000026237
Gene Nameneuromedin U receptor 1
SynonymsGpr66, NMU1R, NmU-R, FM-3
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7601 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location86386303-86426228 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 86388019 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tryptophan at position 41 (C41W)
Ref Sequence ENSEMBL: ENSMUSP00000027440 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027440] [ENSMUST00000212058] [ENSMUST00000212541] [ENSMUST00000212614]
Predicted Effect probably damaging
Transcript: ENSMUST00000027440
AA Change: C41W

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000027440
Gene: ENSMUSG00000026237
AA Change: C41W

DomainStartEndE-ValueType
Pfam:7tm_4 40 231 4.1e-8 PFAM
Pfam:7TM_GPCR_Srsx 48 349 2.6e-8 PFAM
Pfam:7tm_1 54 334 7.8e-50 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000212058
AA Change: C64W

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000212541
AA Change: C8W

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000212614
AA Change: C8W

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice are healthy and viable. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310061I04Rik A G 17: 35,895,849 L16P probably damaging Het
Abcc5 A T 16: 20,375,132 Y746* probably null Het
Abcd4 A G 12: 84,613,945 Y129H possibly damaging Het
Acot10 T C 15: 20,665,629 D342G probably damaging Het
Als2 G T 1: 59,170,002 T1466K probably benign Het
Calcr A T 6: 3,687,603 I465N probably benign Het
Ccndbp1 T C 2: 121,016,146 S309P probably damaging Het
Cdh22 A G 2: 165,112,546 L685P probably damaging Het
Cenps A G 4: 149,132,315 V39A possibly damaging Het
Dbr1 G T 9: 99,582,602 E145* probably null Het
Dync1i1 T A 6: 5,905,129 V161E probably benign Het
F10 A G 8: 13,050,781 T232A probably benign Het
Faim2 C T 15: 99,500,266 G279D probably damaging Het
Fam102b T A 3: 108,988,312 T151S possibly damaging Het
Fam114a2 T C 11: 57,514,216 K20R possibly damaging Het
Hspa4l T C 3: 40,784,356 probably null Het
Impg2 A T 16: 56,260,031 I733L probably benign Het
Itga11 T C 9: 62,696,926 V32A probably benign Het
Lima1 G A 15: 99,819,696 P143L probably benign Het
Lum A T 10: 97,568,306 Y21F probably damaging Het
Muc4 C G 16: 32,753,930 Q1269E probably benign Het
Muc6 A G 7: 141,636,541 S2740P unknown Het
Nav1 A T 1: 135,460,438 D1082E unknown Het
Olfr1281 T C 2: 111,329,220 V267A probably benign Het
Olfr195 A G 16: 59,149,234 N128S probably benign Het
Olfr288 G A 15: 98,186,979 H273Y probably damaging Het
Olfr890 T C 9: 38,143,378 V76A probably benign Het
Pdcd11 T C 19: 47,106,369 S531P not run Het
Phtf1 T A 3: 103,993,845 H403Q probably benign Het
Pigh G A 12: 79,085,705 T111I probably damaging Het
Plekhf1 T C 7: 38,221,880 E88G probably damaging Het
Pnliprp1 C T 19: 58,732,094 T134M probably damaging Het
Ptges T A 2: 30,892,797 Y81F probably benign Het
Sema7a T C 9: 57,940,277 S43P probably benign Het
Sephs2 A T 7: 127,272,946 I325K probably damaging Het
Slc45a1 A T 4: 150,629,537 N750K possibly damaging Het
Sp110 G A 1: 85,579,092 R417C Het
Tbc1d23 A T 16: 57,181,534 M519K probably benign Het
Trdn A G 10: 33,196,156 E273G probably benign Het
Ubtf G A 11: 102,306,654 S724F unknown Het
Was GCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTC GCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTC X: 8,086,211 probably benign Het
Other mutations in Nmur1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00391:Nmur1 APN 1 86386471 missense probably damaging 0.99
IGL00494:Nmur1 APN 1 86386362 missense probably benign
IGL01420:Nmur1 APN 1 86387391 missense probably benign 0.01
IGL02505:Nmur1 APN 1 86386335 missense probably benign 0.00
R0391:Nmur1 UTSW 1 86387678 missense probably damaging 0.99
R1235:Nmur1 UTSW 1 86386693 missense probably damaging 1.00
R4213:Nmur1 UTSW 1 86387784 missense probably damaging 1.00
R4432:Nmur1 UTSW 1 86387565 missense probably damaging 1.00
R4583:Nmur1 UTSW 1 86386645 missense possibly damaging 0.90
R4718:Nmur1 UTSW 1 86387741 missense probably damaging 0.99
R6027:Nmur1 UTSW 1 86387331 nonsense probably null
R7025:Nmur1 UTSW 1 86387848 missense possibly damaging 0.94
R7097:Nmur1 UTSW 1 86387508 missense probably damaging 1.00
R7173:Nmur1 UTSW 1 86386468 missense probably benign 0.00
R7436:Nmur1 UTSW 1 86386378 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- GGTCTCTAAGAGCAGTATTCGG -3'
(R):5'- GTTCCATCTTTCCTGGAGCG -3'

Sequencing Primer
(F):5'- TATTCGGAAGTAGCAGGCACTC -3'
(R):5'- GCTCTCCCCAAATGCTTCAAGG -3'
Posted On2019-10-24