Incidental Mutation 'R7601:Hspa4l'
ID 588000
Institutional Source Beutler Lab
Gene Symbol Hspa4l
Ensembl Gene ENSMUSG00000025757
Gene Name heat shock protein 4 like
Synonyms Osp94, APG-1, 94kDa
MMRRC Submission 045643-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.230) question?
Stock # R7601 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 40699814-40750538 bp(+) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 40738788 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000145468 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108086] [ENSMUST00000203353] [ENSMUST00000204702]
AlphaFold P48722
Predicted Effect probably null
Transcript: ENSMUST00000108086
SMART Domains Protein: ENSMUSP00000103721
Gene: ENSMUSG00000025757

DomainStartEndE-ValueType
Pfam:HSP70 11 673 2.1e-171 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203353
SMART Domains Protein: ENSMUSP00000144787
Gene: ENSMUSG00000025757

DomainStartEndE-ValueType
Pfam:HSP70 3 570 6.2e-184 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000204702
SMART Domains Protein: ENSMUSP00000145468
Gene: ENSMUSG00000025757

DomainStartEndE-ValueType
Pfam:HSP70 3 694 1.3e-192 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is heat shock inducible and may act as a chaperone. The encoded protein can protect the heat-shocked cell against the harmful effects of aggregated proteins. This gene is highly expressed in leukemia cells and may be a good target for therapeutic intervention. Several transcripts encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for disruptions in this gene display increased incidence of male infertility, due to reduced number of mature sperm and reduced sperm motility, and hydronephrosis development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310061I04Rik A G 17: 36,206,741 (GRCm39) L16P probably damaging Het
Abcc5 A T 16: 20,193,882 (GRCm39) Y746* probably null Het
Abcd4 A G 12: 84,660,719 (GRCm39) Y129H possibly damaging Het
Acot10 T C 15: 20,665,715 (GRCm39) D342G probably damaging Het
Als2 G T 1: 59,209,161 (GRCm39) T1466K probably benign Het
Calcr A T 6: 3,687,603 (GRCm39) I465N probably benign Het
Ccndbp1 T C 2: 120,846,627 (GRCm39) S309P probably damaging Het
Cdh22 A G 2: 164,954,466 (GRCm39) L685P probably damaging Het
Cenps A G 4: 149,216,772 (GRCm39) V39A possibly damaging Het
Dbr1 G T 9: 99,464,655 (GRCm39) E145* probably null Het
Dync1i1 T A 6: 5,905,129 (GRCm39) V161E probably benign Het
Eeig2 T A 3: 108,895,628 (GRCm39) T151S possibly damaging Het
F10 A G 8: 13,100,781 (GRCm39) T232A probably benign Het
Faim2 C T 15: 99,398,147 (GRCm39) G279D probably damaging Het
Fam114a2 T C 11: 57,405,042 (GRCm39) K20R possibly damaging Het
Impg2 A T 16: 56,080,394 (GRCm39) I733L probably benign Het
Itga11 T C 9: 62,604,208 (GRCm39) V32A probably benign Het
Lima1 G A 15: 99,717,577 (GRCm39) P143L probably benign Het
Lum A T 10: 97,404,168 (GRCm39) Y21F probably damaging Het
Muc6 A G 7: 141,216,454 (GRCm39) S2740P unknown Het
Nav1 A T 1: 135,388,176 (GRCm39) D1082E unknown Het
Nmur1 A C 1: 86,315,741 (GRCm39) C41W probably damaging Het
Or10ad1c G A 15: 98,084,860 (GRCm39) H273Y probably damaging Het
Or4k37 T C 2: 111,159,565 (GRCm39) V267A probably benign Het
Or5k3 A G 16: 58,969,597 (GRCm39) N128S probably benign Het
Or8b41 T C 9: 38,054,674 (GRCm39) V76A probably benign Het
Pdcd11 T C 19: 47,094,808 (GRCm39) S531P not run Het
Phtf1 T A 3: 103,901,161 (GRCm39) H403Q probably benign Het
Piezo1 C T 8: 123,210,220 (GRCm39) probably null Het
Pigh G A 12: 79,132,479 (GRCm39) T111I probably damaging Het
Plekhf1 T C 7: 37,921,304 (GRCm39) E88G probably damaging Het
Pnliprp1 C T 19: 58,720,526 (GRCm39) T134M probably damaging Het
Ptges T A 2: 30,782,809 (GRCm39) Y81F probably benign Het
Sema7a T C 9: 57,847,560 (GRCm39) S43P probably benign Het
Sephs2 A T 7: 126,872,118 (GRCm39) I325K probably damaging Het
Slc45a1 A T 4: 150,713,994 (GRCm39) N750K possibly damaging Het
Sp110 G A 1: 85,506,813 (GRCm39) R417C probably benign Het
Tbc1d23 A T 16: 57,001,897 (GRCm39) M519K probably benign Het
Trdn A G 10: 33,072,152 (GRCm39) E273G probably benign Het
Ubtf G A 11: 102,197,480 (GRCm39) S724F unknown Het
Was GCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTC GCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTC X: 7,952,450 (GRCm39) probably benign Het
Other mutations in Hspa4l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02466:Hspa4l APN 3 40,707,657 (GRCm39) nonsense probably null
IGL02605:Hspa4l APN 3 40,736,055 (GRCm39) missense probably benign 0.20
IGL02719:Hspa4l APN 3 40,727,090 (GRCm39) missense possibly damaging 0.60
R0281:Hspa4l UTSW 3 40,739,840 (GRCm39) splice site probably benign
R0398:Hspa4l UTSW 3 40,711,429 (GRCm39) splice site probably benign
R0487:Hspa4l UTSW 3 40,738,758 (GRCm39) missense possibly damaging 0.87
R0610:Hspa4l UTSW 3 40,733,832 (GRCm39) missense probably benign 0.01
R0760:Hspa4l UTSW 3 40,739,155 (GRCm39) nonsense probably null
R1491:Hspa4l UTSW 3 40,741,226 (GRCm39) missense probably benign 0.00
R1720:Hspa4l UTSW 3 40,736,049 (GRCm39) nonsense probably null
R1984:Hspa4l UTSW 3 40,714,833 (GRCm39) missense probably damaging 1.00
R1986:Hspa4l UTSW 3 40,714,833 (GRCm39) missense probably damaging 1.00
R2100:Hspa4l UTSW 3 40,727,090 (GRCm39) missense possibly damaging 0.60
R3706:Hspa4l UTSW 3 40,736,125 (GRCm39) missense possibly damaging 0.55
R3708:Hspa4l UTSW 3 40,736,125 (GRCm39) missense possibly damaging 0.55
R3856:Hspa4l UTSW 3 40,739,821 (GRCm39) missense probably benign 0.29
R3874:Hspa4l UTSW 3 40,727,074 (GRCm39) missense probably damaging 1.00
R3890:Hspa4l UTSW 3 40,736,026 (GRCm39) missense possibly damaging 0.90
R4256:Hspa4l UTSW 3 40,700,435 (GRCm39) missense probably benign 0.03
R4364:Hspa4l UTSW 3 40,721,241 (GRCm39) splice site probably null
R4365:Hspa4l UTSW 3 40,721,241 (GRCm39) splice site probably null
R4366:Hspa4l UTSW 3 40,721,241 (GRCm39) splice site probably null
R4493:Hspa4l UTSW 3 40,722,434 (GRCm39) missense possibly damaging 0.77
R4494:Hspa4l UTSW 3 40,707,636 (GRCm39) missense possibly damaging 0.86
R4954:Hspa4l UTSW 3 40,739,832 (GRCm39) critical splice donor site probably null
R4994:Hspa4l UTSW 3 40,700,081 (GRCm39) utr 5 prime probably benign
R5114:Hspa4l UTSW 3 40,700,197 (GRCm39) missense possibly damaging 0.60
R5133:Hspa4l UTSW 3 40,741,179 (GRCm39) missense possibly damaging 0.94
R5202:Hspa4l UTSW 3 40,736,001 (GRCm39) missense probably benign 0.17
R5440:Hspa4l UTSW 3 40,736,008 (GRCm39) missense probably damaging 1.00
R5635:Hspa4l UTSW 3 40,700,177 (GRCm39) missense probably damaging 1.00
R5997:Hspa4l UTSW 3 40,722,411 (GRCm39) missense probably damaging 0.99
R6012:Hspa4l UTSW 3 40,736,031 (GRCm39) missense probably benign 0.09
R6515:Hspa4l UTSW 3 40,736,014 (GRCm39) missense possibly damaging 0.82
R6589:Hspa4l UTSW 3 40,711,487 (GRCm39) missense probably damaging 0.99
R7091:Hspa4l UTSW 3 40,736,024 (GRCm39) missense probably benign 0.00
R8072:Hspa4l UTSW 3 40,741,178 (GRCm39) missense probably damaging 0.98
R9103:Hspa4l UTSW 3 40,715,349 (GRCm39) critical splice donor site probably null
R9146:Hspa4l UTSW 3 40,736,101 (GRCm39) missense probably benign 0.15
R9762:Hspa4l UTSW 3 40,727,057 (GRCm39) missense probably benign 0.01
Z1088:Hspa4l UTSW 3 40,721,425 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTGGCATCATGGTTTTAACTAGC -3'
(R):5'- GCAGACAGCTTATTCATGTCC -3'

Sequencing Primer
(F):5'- GGCATCATGGTTTTAACTAGCAGTTC -3'
(R):5'- CAGCTTATTCATGTCCTAAGTTACAC -3'
Posted On 2019-10-24