Incidental Mutation 'R7601:Fam102b'
ID588002
Institutional Source Beutler Lab
Gene Symbol Fam102b
Ensembl Gene ENSMUSG00000040339
Gene Namefamily with sequence similarity 102, member B
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.157) question?
Stock #R7601 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location108970997-109027607 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 108988312 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 151 (T151S)
Ref Sequence ENSEMBL: ENSMUSP00000131904 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046924] [ENSMUST00000171143]
Predicted Effect probably benign
Transcript: ENSMUST00000046924
AA Change: T120S

PolyPhen 2 Score 0.369 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000039751
Gene: ENSMUSG00000040339
AA Change: T120S

DomainStartEndE-ValueType
Pfam:NT-C2 1 118 7.7e-24 PFAM
low complexity region 230 257 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000171143
AA Change: T151S

PolyPhen 2 Score 0.511 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000131904
Gene: ENSMUSG00000040339
AA Change: T151S

DomainStartEndE-ValueType
Pfam:NT-C2 3 149 1.3e-31 PFAM
low complexity region 261 288 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 98% (40/41)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310061I04Rik A G 17: 35,895,849 L16P probably damaging Het
Abcc5 A T 16: 20,375,132 Y746* probably null Het
Abcd4 A G 12: 84,613,945 Y129H possibly damaging Het
Acot10 T C 15: 20,665,629 D342G probably damaging Het
Als2 G T 1: 59,170,002 T1466K probably benign Het
Calcr A T 6: 3,687,603 I465N probably benign Het
Ccndbp1 T C 2: 121,016,146 S309P probably damaging Het
Cdh22 A G 2: 165,112,546 L685P probably damaging Het
Cenps A G 4: 149,132,315 V39A possibly damaging Het
Dbr1 G T 9: 99,582,602 E145* probably null Het
Dync1i1 T A 6: 5,905,129 V161E probably benign Het
F10 A G 8: 13,050,781 T232A probably benign Het
Faim2 C T 15: 99,500,266 G279D probably damaging Het
Fam114a2 T C 11: 57,514,216 K20R possibly damaging Het
Hspa4l T C 3: 40,784,356 probably null Het
Impg2 A T 16: 56,260,031 I733L probably benign Het
Itga11 T C 9: 62,696,926 V32A probably benign Het
Lima1 G A 15: 99,819,696 P143L probably benign Het
Lum A T 10: 97,568,306 Y21F probably damaging Het
Muc6 A G 7: 141,636,541 S2740P unknown Het
Nav1 A T 1: 135,460,438 D1082E unknown Het
Nmur1 A C 1: 86,388,019 C41W probably damaging Het
Olfr1281 T C 2: 111,329,220 V267A probably benign Het
Olfr195 A G 16: 59,149,234 N128S probably benign Het
Olfr288 G A 15: 98,186,979 H273Y probably damaging Het
Olfr890 T C 9: 38,143,378 V76A probably benign Het
Pdcd11 T C 19: 47,106,369 S531P not run Het
Phtf1 T A 3: 103,993,845 H403Q probably benign Het
Piezo1 C T 8: 122,483,481 probably null Het
Pigh G A 12: 79,085,705 T111I probably damaging Het
Plekhf1 T C 7: 38,221,880 E88G probably damaging Het
Pnliprp1 C T 19: 58,732,094 T134M probably damaging Het
Ptges T A 2: 30,892,797 Y81F probably benign Het
Sema7a T C 9: 57,940,277 S43P probably benign Het
Sephs2 A T 7: 127,272,946 I325K probably damaging Het
Slc45a1 A T 4: 150,629,537 N750K possibly damaging Het
Sp110 G A 1: 85,579,092 R417C Het
Tbc1d23 A T 16: 57,181,534 M519K probably benign Het
Trdn A G 10: 33,196,156 E273G probably benign Het
Ubtf G A 11: 102,306,654 S724F unknown Het
Was GCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTC GCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTC X: 8,086,211 probably benign Het
Other mutations in Fam102b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01326:Fam102b APN 3 108979785 missense possibly damaging 0.94
IGL02415:Fam102b APN 3 108980292 missense probably damaging 1.00
R0362:Fam102b UTSW 3 108980181 missense probably benign 0.37
R0502:Fam102b UTSW 3 108992685 missense probably damaging 1.00
R0505:Fam102b UTSW 3 108980204 missense probably benign 0.00
R0686:Fam102b UTSW 3 108992685 missense probably damaging 1.00
R2568:Fam102b UTSW 3 108978848 missense probably benign 0.09
R3721:Fam102b UTSW 3 108979767 missense probably damaging 1.00
R4466:Fam102b UTSW 3 108979808 missense probably benign 0.31
R4613:Fam102b UTSW 3 109027255 missense probably benign 0.12
R4946:Fam102b UTSW 3 108980228 missense probably benign 0.00
R5182:Fam102b UTSW 3 108985351 missense possibly damaging 0.81
R5831:Fam102b UTSW 3 108992703 missense possibly damaging 0.73
R5930:Fam102b UTSW 3 108980152 missense probably benign 0.00
R7432:Fam102b UTSW 3 109003407 missense probably damaging 0.97
R8309:Fam102b UTSW 3 109027342 start gained probably benign
Predicted Primers PCR Primer
(F):5'- CCAGGCGTTTGTTGAAGAAG -3'
(R):5'- CCTGGGTACACCTCATTACAC -3'

Sequencing Primer
(F):5'- CCAAGATGGGGAAAGATCTCTTAAC -3'
(R):5'- GGTACACCTCATTACACACTTATTTC -3'
Posted On2019-10-24