Incidental Mutation 'R7601:Sephs2'
ID588008
Institutional Source Beutler Lab
Gene Symbol Sephs2
Ensembl Gene ENSMUSG00000049091
Gene Nameselenophosphate synthetase 2
SynonymsSps2, Ysg3
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.734) question?
Stock #R7601 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location127271879-127274055 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 127272946 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 325 (I325K)
Ref Sequence ENSEMBL: ENSMUSP00000081009 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082428]
Predicted Effect probably damaging
Transcript: ENSMUST00000082428
AA Change: I325K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000081009
Gene: ENSMUSG00000049091
AA Change: I325K

DomainStartEndE-ValueType
low complexity region 1 16 N/A INTRINSIC
low complexity region 91 105 N/A INTRINSIC
Pfam:AIRS 118 234 1e-10 PFAM
Pfam:AIRS_C 246 421 2.3e-30 PFAM
low complexity region 433 452 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: This gene encodes an enzyme that synthesizes selenophosphate from selenide and ATP. Selenophosphate is the selenium donor used to synthesize selenocysteine (Sec) that is co-translationally incorporated into selenoproteins at in-frame UGA codons, which normally signal translation termination. This protein itself contains a Sec residue in its predicted active site. The 3' UTR of this gene has a stem-loop secondary structure called a selenocysteine insertion sequence (SECIS) element, which is necessary for the recognition of UGA as a Sec codon rather than as a stop signal. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310061I04Rik A G 17: 35,895,849 L16P probably damaging Het
Abcc5 A T 16: 20,375,132 Y746* probably null Het
Abcd4 A G 12: 84,613,945 Y129H possibly damaging Het
Acot10 T C 15: 20,665,629 D342G probably damaging Het
Als2 G T 1: 59,170,002 T1466K probably benign Het
Calcr A T 6: 3,687,603 I465N probably benign Het
Ccndbp1 T C 2: 121,016,146 S309P probably damaging Het
Cdh22 A G 2: 165,112,546 L685P probably damaging Het
Cenps A G 4: 149,132,315 V39A possibly damaging Het
Dbr1 G T 9: 99,582,602 E145* probably null Het
Dync1i1 T A 6: 5,905,129 V161E probably benign Het
F10 A G 8: 13,050,781 T232A probably benign Het
Faim2 C T 15: 99,500,266 G279D probably damaging Het
Fam102b T A 3: 108,988,312 T151S possibly damaging Het
Fam114a2 T C 11: 57,514,216 K20R possibly damaging Het
Hspa4l T C 3: 40,784,356 probably null Het
Impg2 A T 16: 56,260,031 I733L probably benign Het
Itga11 T C 9: 62,696,926 V32A probably benign Het
Lima1 G A 15: 99,819,696 P143L probably benign Het
Lum A T 10: 97,568,306 Y21F probably damaging Het
Muc6 A G 7: 141,636,541 S2740P unknown Het
Nav1 A T 1: 135,460,438 D1082E unknown Het
Nmur1 A C 1: 86,388,019 C41W probably damaging Het
Olfr1281 T C 2: 111,329,220 V267A probably benign Het
Olfr195 A G 16: 59,149,234 N128S probably benign Het
Olfr288 G A 15: 98,186,979 H273Y probably damaging Het
Olfr890 T C 9: 38,143,378 V76A probably benign Het
Pdcd11 T C 19: 47,106,369 S531P not run Het
Phtf1 T A 3: 103,993,845 H403Q probably benign Het
Piezo1 C T 8: 122,483,481 probably null Het
Pigh G A 12: 79,085,705 T111I probably damaging Het
Plekhf1 T C 7: 38,221,880 E88G probably damaging Het
Pnliprp1 C T 19: 58,732,094 T134M probably damaging Het
Ptges T A 2: 30,892,797 Y81F probably benign Het
Sema7a T C 9: 57,940,277 S43P probably benign Het
Slc45a1 A T 4: 150,629,537 N750K possibly damaging Het
Sp110 G A 1: 85,579,092 R417C Het
Tbc1d23 A T 16: 57,181,534 M519K probably benign Het
Trdn A G 10: 33,196,156 E273G probably benign Het
Ubtf G A 11: 102,306,654 S724F unknown Het
Was GCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTC GCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTC X: 8,086,211 probably benign Het
Other mutations in Sephs2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01694:Sephs2 APN 7 127273087 missense probably benign 0.43
IGL03006:Sephs2 APN 7 127273034 missense probably benign
IGL03295:Sephs2 APN 7 127272769 missense possibly damaging 0.60
R1381:Sephs2 UTSW 7 127272967 missense probably damaging 1.00
R2259:Sephs2 UTSW 7 127273477 missense possibly damaging 0.80
R4876:Sephs2 UTSW 7 127273047 nonsense probably null
R5054:Sephs2 UTSW 7 127273392 missense probably benign 0.05
R5432:Sephs2 UTSW 7 127273805 missense probably damaging 1.00
R6197:Sephs2 UTSW 7 127272901 missense probably damaging 1.00
R6237:Sephs2 UTSW 7 127273946 start gained probably benign
R7138:Sephs2 UTSW 7 127273015 missense possibly damaging 0.96
R7181:Sephs2 UTSW 7 127273820 missense probably benign
R7685:Sephs2 UTSW 7 127273334 missense possibly damaging 0.46
X0061:Sephs2 UTSW 7 127273555 missense probably benign 0.35
Predicted Primers PCR Primer
(F):5'- ACCCTCTCCGTACTTGGAAG -3'
(R):5'- AATGGCTGGATAATCCTGAGAAATG -3'

Sequencing Primer
(F):5'- CTGCTCTCTTGGCAGACAAATCAG -3'
(R):5'- GGAATAAAATCAAGATGGTGGTTTCC -3'
Posted On2019-10-24