Incidental Mutation 'R7601:Itga11'
ID588013
Institutional Source Beutler Lab
Gene Symbol Itga11
Ensembl Gene ENSMUSG00000032243
Gene Nameintegrin alpha 11
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.133) question?
Stock #R7601 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location62677826-62783982 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 62696926 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 32 (V32A)
Ref Sequence ENSEMBL: ENSMUSP00000034774 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034774]
Predicted Effect probably benign
Transcript: ENSMUST00000034774
AA Change: V32A

PolyPhen 2 Score 0.181 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000034774
Gene: ENSMUSG00000032243
AA Change: V32A

DomainStartEndE-ValueType
Int_alpha 37 90 3.9e-7 SMART
VWA 162 350 2.74e-38 SMART
Int_alpha 421 472 2.19e-1 SMART
Int_alpha 476 532 3.75e-9 SMART
Int_alpha 538 593 1.39e-12 SMART
Int_alpha 600 654 1.08e0 SMART
transmembrane domain 1142 1164 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an alpha integrin. Integrins are heterodimeric integral membrane proteins composed of an alpha chain and a beta chain. This protein contains an I domain, is expressed in muscle tissue, dimerizes with beta 1 integrin in vitro, and appears to bind collagen in this form. Therefore, the protein may be involved in attaching muscle tissue to the extracellular matrix. Alternative transcriptional splice variants have been found for this gene, but their biological validity is not determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a disruption of this gene display dwarfism, increased mortality with age, and defective incisors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310061I04Rik A G 17: 35,895,849 L16P probably damaging Het
Abcc5 A T 16: 20,375,132 Y746* probably null Het
Abcd4 A G 12: 84,613,945 Y129H possibly damaging Het
Acot10 T C 15: 20,665,629 D342G probably damaging Het
Als2 G T 1: 59,170,002 T1466K probably benign Het
Calcr A T 6: 3,687,603 I465N probably benign Het
Ccndbp1 T C 2: 121,016,146 S309P probably damaging Het
Cdh22 A G 2: 165,112,546 L685P probably damaging Het
Cenps A G 4: 149,132,315 V39A possibly damaging Het
Dbr1 G T 9: 99,582,602 E145* probably null Het
Dync1i1 T A 6: 5,905,129 V161E probably benign Het
F10 A G 8: 13,050,781 T232A probably benign Het
Faim2 C T 15: 99,500,266 G279D probably damaging Het
Fam102b T A 3: 108,988,312 T151S possibly damaging Het
Fam114a2 T C 11: 57,514,216 K20R possibly damaging Het
Hspa4l T C 3: 40,784,356 probably null Het
Impg2 A T 16: 56,260,031 I733L probably benign Het
Lima1 G A 15: 99,819,696 P143L probably benign Het
Lum A T 10: 97,568,306 Y21F probably damaging Het
Muc4 C G 16: 32,753,930 Q1269E probably benign Het
Muc6 A G 7: 141,636,541 S2740P unknown Het
Nav1 A T 1: 135,460,438 D1082E unknown Het
Nmur1 A C 1: 86,388,019 C41W probably damaging Het
Olfr1281 T C 2: 111,329,220 V267A probably benign Het
Olfr195 A G 16: 59,149,234 N128S probably benign Het
Olfr288 G A 15: 98,186,979 H273Y probably damaging Het
Olfr890 T C 9: 38,143,378 V76A probably benign Het
Pdcd11 T C 19: 47,106,369 S531P not run Het
Phtf1 T A 3: 103,993,845 H403Q probably benign Het
Pigh G A 12: 79,085,705 T111I probably damaging Het
Plekhf1 T C 7: 38,221,880 E88G probably damaging Het
Pnliprp1 C T 19: 58,732,094 T134M probably damaging Het
Ptges T A 2: 30,892,797 Y81F probably benign Het
Sema7a T C 9: 57,940,277 S43P probably benign Het
Sephs2 A T 7: 127,272,946 I325K probably damaging Het
Slc45a1 A T 4: 150,629,537 N750K possibly damaging Het
Sp110 G A 1: 85,579,092 R417C Het
Tbc1d23 A T 16: 57,181,534 M519K probably benign Het
Trdn A G 10: 33,196,156 E273G probably benign Het
Ubtf G A 11: 102,306,654 S724F unknown Het
Was GCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTC GCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTC X: 8,086,211 probably benign Het
Other mutations in Itga11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00933:Itga11 APN 9 62769305 missense possibly damaging 0.58
IGL01108:Itga11 APN 9 62757621 missense probably benign
IGL01348:Itga11 APN 9 62744579 missense possibly damaging 0.83
IGL01739:Itga11 APN 9 62774117 missense probably benign 0.03
IGL01918:Itga11 APN 9 62772996 missense probably benign 0.05
IGL02237:Itga11 APN 9 62755775 critical splice donor site probably null
IGL02418:Itga11 APN 9 62744632 missense probably benign 0.30
IGL02451:Itga11 APN 9 62735353 missense probably damaging 1.00
sneezy UTSW 9 62732109 missense probably damaging 1.00
PIT4812001:Itga11 UTSW 9 62732193 missense probably damaging 1.00
R0013:Itga11 UTSW 9 62776613 missense possibly damaging 0.89
R0013:Itga11 UTSW 9 62776613 missense possibly damaging 0.89
R0032:Itga11 UTSW 9 62774095 missense probably benign 0.05
R0032:Itga11 UTSW 9 62774095 missense probably benign 0.05
R0101:Itga11 UTSW 9 62744486 missense probably damaging 1.00
R0114:Itga11 UTSW 9 62735293 missense probably damaging 1.00
R0114:Itga11 UTSW 9 62760302 missense possibly damaging 0.85
R0212:Itga11 UTSW 9 62745969 missense probably benign 0.22
R0310:Itga11 UTSW 9 62760346 missense probably damaging 1.00
R0455:Itga11 UTSW 9 62696961 missense probably damaging 1.00
R0558:Itga11 UTSW 9 62752288 missense probably benign 0.01
R0607:Itga11 UTSW 9 62774371 missense probably benign 0.00
R0924:Itga11 UTSW 9 62776674 missense probably benign 0.14
R1085:Itga11 UTSW 9 62677970 missense probably benign 0.03
R1477:Itga11 UTSW 9 62755211 missense probably benign
R1647:Itga11 UTSW 9 62760370 missense probably benign 0.01
R1831:Itga11 UTSW 9 62782018 missense probably damaging 1.00
R1880:Itga11 UTSW 9 62677949 missense probably benign 0.06
R1934:Itga11 UTSW 9 62744514 missense probably damaging 1.00
R2025:Itga11 UTSW 9 62762811 missense probably damaging 1.00
R2046:Itga11 UTSW 9 62727697 missense probably damaging 1.00
R2145:Itga11 UTSW 9 62732204 splice site probably benign
R2922:Itga11 UTSW 9 62768630 splice site probably benign
R3011:Itga11 UTSW 9 62696980 missense probably damaging 0.99
R3158:Itga11 UTSW 9 62769278 missense probably benign 0.02
R3809:Itga11 UTSW 9 62771382 missense probably benign
R3836:Itga11 UTSW 9 62769283 missense probably benign 0.00
R4051:Itga11 UTSW 9 62755651 nonsense probably null
R4190:Itga11 UTSW 9 62732109 missense probably damaging 1.00
R4510:Itga11 UTSW 9 62761588 missense probably damaging 0.96
R4511:Itga11 UTSW 9 62761588 missense probably damaging 0.96
R4678:Itga11 UTSW 9 62735357 missense probably damaging 0.98
R4706:Itga11 UTSW 9 62755296 missense possibly damaging 0.64
R4713:Itga11 UTSW 9 62765788 missense probably damaging 1.00
R4798:Itga11 UTSW 9 62776727 splice site probably null
R4909:Itga11 UTSW 9 62755299 missense probably damaging 1.00
R4915:Itga11 UTSW 9 62752248 nonsense probably null
R4957:Itga11 UTSW 9 62767648 missense probably benign 0.00
R4962:Itga11 UTSW 9 62761568 nonsense probably null
R5081:Itga11 UTSW 9 62755196 missense probably benign 0.13
R5265:Itga11 UTSW 9 62737412 missense probably benign 0.05
R5308:Itga11 UTSW 9 62755769 missense probably benign
R5398:Itga11 UTSW 9 62745923 missense probably benign 0.21
R5717:Itga11 UTSW 9 62752249 missense probably benign 0.26
R5885:Itga11 UTSW 9 62762850 missense probably damaging 0.99
R5996:Itga11 UTSW 9 62755673 missense probably benign 0.01
R6394:Itga11 UTSW 9 62735266 splice site probably null
R6751:Itga11 UTSW 9 62768584 missense probably benign 0.02
R7041:Itga11 UTSW 9 62752256 missense probably damaging 1.00
R7264:Itga11 UTSW 9 62745908 missense probably benign 0.02
R7509:Itga11 UTSW 9 62781940 missense probably benign
R7615:Itga11 UTSW 9 62744018 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATGGTCTGCCGTTCAAACTG -3'
(R):5'- TGATTTCTAGGAATCAGGAAGCC -3'

Sequencing Primer
(F):5'- AACTGTATCTTCTCAAGGTAGGGCC -3'
(R):5'- AGGAAGCCTGGGAGAACC -3'
Posted On2019-10-24