Incidental Mutation 'R7601:Lum'
ID 588016
Institutional Source Beutler Lab
Gene Symbol Lum
Ensembl Gene ENSMUSG00000036446
Gene Name lumican
Synonyms Ldc, SLRR2D
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.256) question?
Stock # R7601 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 97565128-97572703 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 97568306 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 21 (Y21F)
Ref Sequence ENSEMBL: ENSMUSP00000040877 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038160]
AlphaFold P51885
Predicted Effect probably damaging
Transcript: ENSMUST00000038160
AA Change: Y21F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000040877
Gene: ENSMUSG00000036446
AA Change: Y21F

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
LRRNT 36 70 1.02e-10 SMART
LRR 66 88 2.14e1 SMART
LRR 89 114 1.92e2 SMART
LRR 135 157 1.67e2 SMART
LRR 158 181 7.8e1 SMART
LRR_TYP 183 206 2.36e-2 SMART
LRR 207 227 6.41e1 SMART
LRR 228 253 6.59e1 SMART
LRR 254 275 4.45e1 SMART
LRR 303 328 3.18e2 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the small leucine-rich proteoglycan (SLRP) family that includes decorin, biglycan, fibromodulin, keratocan, epiphycan, and osteoglycin. In these bifunctional molecules, the protein moiety binds collagen fibrils and the highly charged hydrophilic glycosaminoglycans regulate interfibrillar spacings. Lumican is the major keratan sulfate proteoglycan of the cornea but is also distributed in interstitial collagenous matrices throughout the body. Lumican may regulate collagen fibril organization and circumferential growth, corneal transparency, and epithelial cell migration and tissue repair. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for targeted disruptions of this gene have abnormally large and aberrantly contoured collagen fibrils forming a disorganized matrix in the tendon, skin, cornea and sclera, with consequent reductions in skin tensile strength and corneal clarity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310061I04Rik A G 17: 35,895,849 L16P probably damaging Het
Abcc5 A T 16: 20,375,132 Y746* probably null Het
Abcd4 A G 12: 84,613,945 Y129H possibly damaging Het
Acot10 T C 15: 20,665,629 D342G probably damaging Het
Als2 G T 1: 59,170,002 T1466K probably benign Het
Calcr A T 6: 3,687,603 I465N probably benign Het
Ccndbp1 T C 2: 121,016,146 S309P probably damaging Het
Cdh22 A G 2: 165,112,546 L685P probably damaging Het
Cenps A G 4: 149,132,315 V39A possibly damaging Het
Dbr1 G T 9: 99,582,602 E145* probably null Het
Dync1i1 T A 6: 5,905,129 V161E probably benign Het
F10 A G 8: 13,050,781 T232A probably benign Het
Faim2 C T 15: 99,500,266 G279D probably damaging Het
Fam102b T A 3: 108,988,312 T151S possibly damaging Het
Fam114a2 T C 11: 57,514,216 K20R possibly damaging Het
Hspa4l T C 3: 40,784,356 probably null Het
Impg2 A T 16: 56,260,031 I733L probably benign Het
Itga11 T C 9: 62,696,926 V32A probably benign Het
Lima1 G A 15: 99,819,696 P143L probably benign Het
Muc6 A G 7: 141,636,541 S2740P unknown Het
Nav1 A T 1: 135,460,438 D1082E unknown Het
Nmur1 A C 1: 86,388,019 C41W probably damaging Het
Olfr1281 T C 2: 111,329,220 V267A probably benign Het
Olfr195 A G 16: 59,149,234 N128S probably benign Het
Olfr288 G A 15: 98,186,979 H273Y probably damaging Het
Olfr890 T C 9: 38,143,378 V76A probably benign Het
Pdcd11 T C 19: 47,106,369 S531P not run Het
Phtf1 T A 3: 103,993,845 H403Q probably benign Het
Piezo1 C T 8: 122,483,481 probably null Het
Pigh G A 12: 79,085,705 T111I probably damaging Het
Plekhf1 T C 7: 38,221,880 E88G probably damaging Het
Pnliprp1 C T 19: 58,732,094 T134M probably damaging Het
Ptges T A 2: 30,892,797 Y81F probably benign Het
Sema7a T C 9: 57,940,277 S43P probably benign Het
Sephs2 A T 7: 127,272,946 I325K probably damaging Het
Slc45a1 A T 4: 150,629,537 N750K possibly damaging Het
Sp110 G A 1: 85,579,092 R417C probably benign Het
Tbc1d23 A T 16: 57,181,534 M519K probably benign Het
Trdn A G 10: 33,196,156 E273G probably benign Het
Ubtf G A 11: 102,306,654 S724F unknown Het
Was GCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTC GCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTC X: 8,086,211 probably benign Het
Other mutations in Lum
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01347:Lum APN 10 97568685 missense probably damaging 1.00
IGL01394:Lum APN 10 97568972 missense probably damaging 1.00
IGL02160:Lum APN 10 97568581 missense probably damaging 0.96
IGL02659:Lum APN 10 97568747 missense probably benign
PIT4305001:Lum UTSW 10 97568876 missense probably damaging 1.00
R0352:Lum UTSW 10 97568609 missense probably damaging 0.97
R0403:Lum UTSW 10 97572043 missense probably benign 0.05
R1446:Lum UTSW 10 97568390 missense possibly damaging 0.88
R2760:Lum UTSW 10 97568771 missense probably benign 0.16
R4154:Lum UTSW 10 97568953 missense probably damaging 1.00
R4492:Lum UTSW 10 97568438 missense probably damaging 1.00
R8058:Lum UTSW 10 97568563 missense probably benign 0.00
R8747:Lum UTSW 10 97568489 missense possibly damaging 0.88
R9334:Lum UTSW 10 97568485 missense probably damaging 1.00
R9360:Lum UTSW 10 97568890 nonsense probably null
R9800:Lum UTSW 10 97568295 missense probably benign 0.00
X0065:Lum UTSW 10 97568980 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GAAGACACTATTTTGGAGGCAC -3'
(R):5'- ACGTTCTCAAAGGCCTTCTC -3'

Sequencing Primer
(F):5'- CACTATTTTGGAGGCACTGAAAATG -3'
(R):5'- CAAAGGCCTTCTCATCAATATGGTCG -3'
Posted On 2019-10-24