Incidental Mutation 'R7601:Acot10'
ID 588021
Institutional Source Beutler Lab
Gene Symbol Acot10
Ensembl Gene ENSMUSG00000047565
Gene Name acyl-CoA thioesterase 10
Synonyms MT-ACT48, p48, Acate3
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.145) question?
Stock # R7601 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 20665214-20666750 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 20665629 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 342 (D342G)
Ref Sequence ENSEMBL: ENSMUSP00000051333 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052910]
AlphaFold Q32MW3
Predicted Effect probably damaging
Transcript: ENSMUST00000052910
AA Change: D342G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000051333
Gene: ENSMUSG00000047565
AA Change: D342G

DomainStartEndE-ValueType
SCOP:d1lo7a_ 108 222 1e-4 SMART
PDB:4IEN|D 277 400 3e-6 PDB
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 98% (40/41)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310061I04Rik A G 17: 35,895,849 L16P probably damaging Het
Abcc5 A T 16: 20,375,132 Y746* probably null Het
Abcd4 A G 12: 84,613,945 Y129H possibly damaging Het
Als2 G T 1: 59,170,002 T1466K probably benign Het
Calcr A T 6: 3,687,603 I465N probably benign Het
Ccndbp1 T C 2: 121,016,146 S309P probably damaging Het
Cdh22 A G 2: 165,112,546 L685P probably damaging Het
Cenps A G 4: 149,132,315 V39A possibly damaging Het
Dbr1 G T 9: 99,582,602 E145* probably null Het
Dync1i1 T A 6: 5,905,129 V161E probably benign Het
F10 A G 8: 13,050,781 T232A probably benign Het
Faim2 C T 15: 99,500,266 G279D probably damaging Het
Fam102b T A 3: 108,988,312 T151S possibly damaging Het
Fam114a2 T C 11: 57,514,216 K20R possibly damaging Het
Hspa4l T C 3: 40,784,356 probably null Het
Impg2 A T 16: 56,260,031 I733L probably benign Het
Itga11 T C 9: 62,696,926 V32A probably benign Het
Lima1 G A 15: 99,819,696 P143L probably benign Het
Lum A T 10: 97,568,306 Y21F probably damaging Het
Muc6 A G 7: 141,636,541 S2740P unknown Het
Nav1 A T 1: 135,460,438 D1082E unknown Het
Nmur1 A C 1: 86,388,019 C41W probably damaging Het
Olfr1281 T C 2: 111,329,220 V267A probably benign Het
Olfr195 A G 16: 59,149,234 N128S probably benign Het
Olfr288 G A 15: 98,186,979 H273Y probably damaging Het
Olfr890 T C 9: 38,143,378 V76A probably benign Het
Pdcd11 T C 19: 47,106,369 S531P not run Het
Phtf1 T A 3: 103,993,845 H403Q probably benign Het
Piezo1 C T 8: 122,483,481 probably null Het
Pigh G A 12: 79,085,705 T111I probably damaging Het
Plekhf1 T C 7: 38,221,880 E88G probably damaging Het
Pnliprp1 C T 19: 58,732,094 T134M probably damaging Het
Ptges T A 2: 30,892,797 Y81F probably benign Het
Sema7a T C 9: 57,940,277 S43P probably benign Het
Sephs2 A T 7: 127,272,946 I325K probably damaging Het
Slc45a1 A T 4: 150,629,537 N750K possibly damaging Het
Sp110 G A 1: 85,579,092 R417C probably benign Het
Tbc1d23 A T 16: 57,181,534 M519K probably benign Het
Trdn A G 10: 33,196,156 E273G probably benign Het
Ubtf G A 11: 102,306,654 S724F unknown Het
Was GCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTC GCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTC X: 8,086,211 probably benign Het
Other mutations in Acot10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01306:Acot10 APN 15 20665965 missense probably benign 0.11
IGL01610:Acot10 APN 15 20665695 missense probably damaging 1.00
IGL02457:Acot10 APN 15 20666143 missense possibly damaging 0.88
IGL02587:Acot10 APN 15 20665797 missense possibly damaging 0.93
IGL02951:Acot10 APN 15 20665782 missense probably benign 0.36
ANU23:Acot10 UTSW 15 20665965 missense probably benign 0.11
PIT4151001:Acot10 UTSW 15 20666598 missense probably damaging 0.98
R0026:Acot10 UTSW 15 20666236 missense probably benign 0.10
R0026:Acot10 UTSW 15 20666236 missense probably benign 0.10
R0462:Acot10 UTSW 15 20666626 missense possibly damaging 0.85
R1312:Acot10 UTSW 15 20666499 missense probably benign 0.00
R1495:Acot10 UTSW 15 20665507 missense probably damaging 0.99
R2128:Acot10 UTSW 15 20666626 missense probably benign 0.00
R3779:Acot10 UTSW 15 20665542 missense probably damaging 0.98
R4110:Acot10 UTSW 15 20666526 missense probably damaging 1.00
R4111:Acot10 UTSW 15 20666526 missense probably damaging 1.00
R4464:Acot10 UTSW 15 20665744 nonsense probably null
R4668:Acot10 UTSW 15 20665942 missense probably benign
R4933:Acot10 UTSW 15 20666330 missense possibly damaging 0.88
R5255:Acot10 UTSW 15 20665932 missense probably benign 0.01
R5885:Acot10 UTSW 15 20666104 missense probably benign 0.01
R6190:Acot10 UTSW 15 20665785 missense possibly damaging 0.80
R6301:Acot10 UTSW 15 20666262 missense probably benign 0.05
R6805:Acot10 UTSW 15 20665366 missense probably benign 0.42
R7334:Acot10 UTSW 15 20665543 missense possibly damaging 0.86
R8400:Acot10 UTSW 15 20666172 missense possibly damaging 0.56
R9195:Acot10 UTSW 15 20665431 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGCTGTCCATCTAAATACAACATGG -3'
(R):5'- TCCTAAGGCAGTGTGGATGG -3'

Sequencing Primer
(F):5'- CAAGGGTACTTCTTTTTCTGACATG -3'
(R):5'- TGTGGATGGAGGATACAAAACTC -3'
Posted On 2019-10-24