Incidental Mutation 'R7601:Was'
ID 588033
Institutional Source Beutler Lab
Gene Symbol Was
Ensembl Gene ENSMUSG00000031165
Gene Name Wiskott-Aldrich syndrome
Synonyms U42471, Wasp
MMRRC Submission 045643-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.355) question?
Stock # R7601 (G1)
Quality Score 114.467
Status Not validated
Chromosome X
Chromosomal Location 7947705-7956730 bp(-) (GRCm39)
Type of Mutation small deletion (1 aa in frame mutation)
DNA Base Change (assembly) GCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTC to GCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTC at 7952450 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000033505 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033505]
AlphaFold P70315
Predicted Effect probably benign
Transcript: ENSMUST00000033505
SMART Domains Protein: ENSMUSP00000033505
Gene: ENSMUSG00000031165

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
WH1 41 147 5.3e-42 SMART
low complexity region 174 200 N/A INTRINSIC
low complexity region 227 237 N/A INTRINSIC
PBD 240 276 2.71e-10 SMART
low complexity region 314 321 N/A INTRINSIC
WH2 448 465 6.55e-5 SMART
SCOP:d1ej5a_ 478 510 4e-13 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Wiskott-Aldrich syndrome (WAS) family of proteins share similar domain structure, and are involved in transduction of signals from receptors on the cell surface to the actin cytoskeleton. The presence of a number of different motifs suggests that they are regulated by a number of different stimuli, and interact with multiple proteins. Recent studies have demonstrated that these proteins, directly or indirectly, associate with the small GTPase, Cdc42, known to regulate formation of actin filaments, and the cytoskeletal organizing complex, Arp2/3. Wiskott-Aldrich syndrome is a rare, inherited, X-linked, recessive disease characterized by immune dysregulation and microthrombocytopenia, and is caused by mutations in the WAS gene. The WAS gene product is a cytoplasmic protein, expressed exclusively in hematopoietic cells, which show signalling and cytoskeletal abnormalities in WAS patients. A transcript variant arising as a result of alternative promoter usage, and containing a different 5' UTR sequence, has been described, however, its full-length nature is not known. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant females and hemizygous mutant males exhibit reduced numbers of peripheral blood lymphocytes and platelets, but increased numbers of neutrophils. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310061I04Rik A G 17: 36,206,741 (GRCm39) L16P probably damaging Het
Abcc5 A T 16: 20,193,882 (GRCm39) Y746* probably null Het
Abcd4 A G 12: 84,660,719 (GRCm39) Y129H possibly damaging Het
Acot10 T C 15: 20,665,715 (GRCm39) D342G probably damaging Het
Als2 G T 1: 59,209,161 (GRCm39) T1466K probably benign Het
Calcr A T 6: 3,687,603 (GRCm39) I465N probably benign Het
Ccndbp1 T C 2: 120,846,627 (GRCm39) S309P probably damaging Het
Cdh22 A G 2: 164,954,466 (GRCm39) L685P probably damaging Het
Cenps A G 4: 149,216,772 (GRCm39) V39A possibly damaging Het
Dbr1 G T 9: 99,464,655 (GRCm39) E145* probably null Het
Dync1i1 T A 6: 5,905,129 (GRCm39) V161E probably benign Het
Eeig2 T A 3: 108,895,628 (GRCm39) T151S possibly damaging Het
F10 A G 8: 13,100,781 (GRCm39) T232A probably benign Het
Faim2 C T 15: 99,398,147 (GRCm39) G279D probably damaging Het
Fam114a2 T C 11: 57,405,042 (GRCm39) K20R possibly damaging Het
Hspa4l T C 3: 40,738,788 (GRCm39) probably null Het
Impg2 A T 16: 56,080,394 (GRCm39) I733L probably benign Het
Itga11 T C 9: 62,604,208 (GRCm39) V32A probably benign Het
Lima1 G A 15: 99,717,577 (GRCm39) P143L probably benign Het
Lum A T 10: 97,404,168 (GRCm39) Y21F probably damaging Het
Muc6 A G 7: 141,216,454 (GRCm39) S2740P unknown Het
Nav1 A T 1: 135,388,176 (GRCm39) D1082E unknown Het
Nmur1 A C 1: 86,315,741 (GRCm39) C41W probably damaging Het
Or10ad1c G A 15: 98,084,860 (GRCm39) H273Y probably damaging Het
Or4k37 T C 2: 111,159,565 (GRCm39) V267A probably benign Het
Or5k3 A G 16: 58,969,597 (GRCm39) N128S probably benign Het
Or8b41 T C 9: 38,054,674 (GRCm39) V76A probably benign Het
Pdcd11 T C 19: 47,094,808 (GRCm39) S531P not run Het
Phtf1 T A 3: 103,901,161 (GRCm39) H403Q probably benign Het
Piezo1 C T 8: 123,210,220 (GRCm39) probably null Het
Pigh G A 12: 79,132,479 (GRCm39) T111I probably damaging Het
Plekhf1 T C 7: 37,921,304 (GRCm39) E88G probably damaging Het
Pnliprp1 C T 19: 58,720,526 (GRCm39) T134M probably damaging Het
Ptges T A 2: 30,782,809 (GRCm39) Y81F probably benign Het
Sema7a T C 9: 57,847,560 (GRCm39) S43P probably benign Het
Sephs2 A T 7: 126,872,118 (GRCm39) I325K probably damaging Het
Slc45a1 A T 4: 150,713,994 (GRCm39) N750K possibly damaging Het
Sp110 G A 1: 85,506,813 (GRCm39) R417C probably benign Het
Tbc1d23 A T 16: 57,001,897 (GRCm39) M519K probably benign Het
Trdn A G 10: 33,072,152 (GRCm39) E273G probably benign Het
Ubtf G A 11: 102,197,480 (GRCm39) S724F unknown Het
Other mutations in Was
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01409:Was APN X 7,954,055 (GRCm39) missense probably damaging 1.00
IGL02100:Was APN X 7,956,554 (GRCm39) missense possibly damaging 0.54
R3709:Was UTSW X 7,952,927 (GRCm39) missense probably benign 0.05
R3710:Was UTSW X 7,952,927 (GRCm39) missense probably benign 0.05
R6818:Was UTSW X 7,952,450 (GRCm39) small deletion probably benign
RF012:Was UTSW X 7,952,470 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- ATTTGGTCCAAAAGTGCACC -3'
(R):5'- CTGGTCCTGAAGGTTGTTATCC -3'

Sequencing Primer
(F):5'- TGGTCCCCCAGCTCCAG -3'
(R):5'- TCAGCCTGGTCTACAAAGTG -3'
Posted On 2019-10-24