Incidental Mutation 'R7602:Sirpa'
ID588044
Institutional Source Beutler Lab
Gene Symbol Sirpa
Ensembl Gene ENSMUSG00000037902
Gene Namesignal-regulatory protein alpha
SynonymsSIRP, Ptpns1, CD172a, P84, SHPS-1, Bit
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7602 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location129592835-129632228 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 129609152 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 111 (V111F)
Ref Sequence ENSEMBL: ENSMUSP00000049022 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049262] [ENSMUST00000099113] [ENSMUST00000103202] [ENSMUST00000103203] [ENSMUST00000153491] [ENSMUST00000160276] [ENSMUST00000161620] [ENSMUST00000163034] [ENSMUST00000179001]
Predicted Effect probably damaging
Transcript: ENSMUST00000049262
AA Change: V111F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000049022
Gene: ENSMUSG00000037902
AA Change: V111F

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
IG 40 146 1.78e-9 SMART
IGc1 166 239 5.4e-4 SMART
IGc1 269 342 8.51e-7 SMART
transmembrane domain 374 396 N/A INTRINSIC
low complexity region 446 458 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000099113
AA Change: V111F
SMART Domains Protein: ENSMUSP00000096713
Gene: ENSMUSG00000037902
AA Change: V111F

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
IG 40 146 1.78e-9 SMART
transmembrane domain 156 178 N/A INTRINSIC
low complexity region 228 240 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000103202
AA Change: V111F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099491
Gene: ENSMUSG00000037902
AA Change: V111F

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
IG 40 146 1.78e-9 SMART
IGc1 166 239 5.4e-4 SMART
IGc1 269 342 8.51e-7 SMART
transmembrane domain 374 396 N/A INTRINSIC
low complexity region 442 454 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000103203
AA Change: V111F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099492
Gene: ENSMUSG00000037902
AA Change: V111F

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
IG 40 146 1.78e-9 SMART
IGc1 166 239 5.4e-4 SMART
IGc1 269 342 8.51e-7 SMART
transmembrane domain 374 396 N/A INTRINSIC
low complexity region 442 454 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000153491
AA Change: V111F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000120324
Gene: ENSMUSG00000037902
AA Change: V111F

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
IG 40 146 1.78e-9 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000160276
AA Change: V111F

PolyPhen 2 Score 0.818 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000125004
Gene: ENSMUSG00000037902
AA Change: V111F

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
IG 40 146 1.78e-9 SMART
transmembrane domain 156 178 N/A INTRINSIC
low complexity region 224 236 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000161620
AA Change: V111F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124048
Gene: ENSMUSG00000037902
AA Change: V111F

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
IG 40 146 1.78e-9 SMART
IGc1 166 239 5.4e-4 SMART
IGc1 269 342 8.51e-7 SMART
transmembrane domain 374 396 N/A INTRINSIC
low complexity region 446 458 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163034
SMART Domains Protein: ENSMUSP00000124888
Gene: ENSMUSG00000037902

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
transmembrane domain 37 59 N/A INTRINSIC
low complexity region 105 117 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000179001
AA Change: V111F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000137611
Gene: ENSMUSG00000037902
AA Change: V111F

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
IG 40 146 1.78e-9 SMART
IGc1 166 239 5.4e-4 SMART
IGc1 269 342 8.51e-7 SMART
transmembrane domain 374 396 N/A INTRINSIC
low complexity region 442 454 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the signal-regulatory-protein (SIRP) family, and also belongs to the immunoglobulin superfamily. SIRP family members are receptor-type transmembrane glycoproteins known to be involved in the negative regulation of receptor tyrosine kinase-coupled signaling processes. This protein can be phosphorylated by tyrosine kinases. The phospho-tyrosine residues of this PTP have been shown to recruit SH2 domain containing tyrosine phosphatases (PTP), and serve as substrates of PTPs. This protein was found to participate in signal transduction mediated by various growth factor receptors. CD47 has been demonstrated to be a ligand for this receptor protein. This gene and its product share very high similarity with several other members of the SIRP family. These related genes are located in close proximity to each other on chromosome 20p13. Multiple alternatively spliced transcript variants have been determined for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display mild thrombocytopenia, fatty livers, decreased body weight, decreased proportion of single positive T cells, enhanced peritoneal macrophage phagocytosis and impaired Langerhans cell migration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700023F06Rik T C 11: 103,200,178 M114V probably benign Het
1700025G04Rik A T 1: 151,980,515 Y34N probably damaging Het
5730559C18Rik G T 1: 136,225,397 C252* probably null Het
A2m T C 6: 121,642,007 V237A probably damaging Het
A2m A T 6: 121,670,936 D1129V possibly damaging Het
Abca7 A G 10: 79,998,012 probably null Het
Ap3m2 T C 8: 22,792,754 N256S probably benign Het
Atr C T 9: 95,907,383 H1531Y possibly damaging Het
Carmil3 C T 14: 55,501,508 A873V probably null Het
Casp8 A C 1: 58,833,739 K258T probably benign Het
Cast A G 13: 74,736,965 S222P probably benign Het
Cpsf7 C T 19: 10,535,373 P274S probably damaging Het
Ddx24 A T 12: 103,416,260 L688* probably null Het
Ddx59 A G 1: 136,433,821 I475V probably benign Het
Dhx29 T A 13: 112,944,559 S376T possibly damaging Het
Dhx57 G T 17: 80,274,861 N438K probably benign Het
Dlk1 T A 12: 109,455,625 probably null Het
Epha6 T C 16: 59,775,568 D920G probably damaging Het
Exo5 A T 4: 120,921,621 V349E probably benign Het
Fam234b T C 6: 135,225,243 V321A possibly damaging Het
Gbp3 A G 3: 142,569,061 E383G probably benign Het
Gga2 T C 7: 121,997,330 N408S probably benign Het
Gm5346 C T 8: 43,626,666 G174R probably damaging Het
Gm8298 T C 3: 59,877,276 I390T probably benign Het
Gse1 T C 8: 120,569,304 V532A unknown Het
Hnrnpul2 T C 19: 8,831,309 Y712H probably damaging Het
Hpca T C 4: 129,120,226 probably benign Het
Ifitm3 A G 7: 141,010,459 F63L probably damaging Het
Kank1 A T 19: 25,422,161 T940S probably benign Het
Klhl9 C A 4: 88,722,409 probably benign Het
Krt36 T C 11: 100,102,960 M351V probably benign Het
Mthfd2 T C 6: 83,311,848 N125D probably benign Het
Muc4 C G 16: 32,753,930 Q1269E probably benign Het
Ncoa2 A G 1: 13,177,126 S358P possibly damaging Het
Nmnat1 T C 4: 149,473,351 H78R probably benign Het
Olfr1026 A T 2: 85,923,802 Y178F probably damaging Het
Olfr173 T C 16: 58,796,980 I289V possibly damaging Het
Olfr823 A G 10: 130,112,310 M160T probably benign Het
Olfr982 T G 9: 40,075,159 L288R probably damaging Het
Pabpc4 A T 4: 123,292,892 D302V possibly damaging Het
Pgap1 A T 1: 54,543,186 S167R probably damaging Het
Phf12 T C 11: 78,023,283 L517P probably benign Het
Rcan2 A G 17: 44,017,798 D86G probably benign Het
Ryk T C 9: 102,898,516 Y442H probably damaging Het
Scfd2 G T 5: 74,462,610 Q421K probably benign Het
Skint4 A T 4: 112,118,271 T143S possibly damaging Het
Slc12a8 C A 16: 33,625,124 H463N probably benign Het
Sp110 G A 1: 85,579,092 R417C Het
Sptlc2 A G 12: 87,341,689 Y340H probably damaging Het
Ssc5d T A 7: 4,942,746 W926R possibly damaging Het
Tgfa A G 6: 86,269,962 E82G probably damaging Het
Thrsp A G 7: 97,417,307 I66T probably damaging Het
Ttn T C 2: 76,851,644 E1003G unknown Het
Tube1 A T 10: 39,142,266 H113L probably benign Het
Uri1 A G 7: 37,981,628 V117A probably benign Het
Ush2a G A 1: 188,648,409 C2305Y probably damaging Het
Zbtb7a T G 10: 81,144,176 V68G probably damaging Het
Zfr T A 15: 12,159,677 D686E possibly damaging Het
Zscan4f G A 7: 11,401,381 S238N possibly damaging Het
Other mutations in Sirpa
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00835:Sirpa APN 2 129609183 missense probably damaging 1.00
IGL01138:Sirpa APN 2 129630165 missense probably damaging 1.00
IGL01835:Sirpa APN 2 129615564 missense possibly damaging 0.76
IGL02558:Sirpa APN 2 129630069 missense probably damaging 1.00
IGL02825:Sirpa APN 2 129615452 missense probably damaging 0.99
IGL03083:Sirpa APN 2 129629928 missense probably damaging 1.00
R0234:Sirpa UTSW 2 129615468 missense probably damaging 0.99
R0234:Sirpa UTSW 2 129615468 missense probably damaging 0.99
R0831:Sirpa UTSW 2 129627936 splice site probably benign
R1550:Sirpa UTSW 2 129630041 missense probably damaging 1.00
R1772:Sirpa UTSW 2 129616456 missense probably damaging 0.99
R1806:Sirpa UTSW 2 129615512 missense probably damaging 1.00
R1927:Sirpa UTSW 2 129616376 missense possibly damaging 0.46
R2568:Sirpa UTSW 2 129615648 missense probably benign 0.02
R4849:Sirpa UTSW 2 129609243 missense probably damaging 1.00
R5182:Sirpa UTSW 2 129615732 missense possibly damaging 0.65
R5673:Sirpa UTSW 2 129630102 missense probably damaging 1.00
R5680:Sirpa UTSW 2 129616252 missense probably benign 0.02
R6521:Sirpa UTSW 2 129630155 missense probably damaging 1.00
R6821:Sirpa UTSW 2 129630097 missense probably damaging 1.00
R7637:Sirpa UTSW 2 129616445 missense probably benign 0.44
RF018:Sirpa UTSW 2 129609203 nonsense probably null
RF049:Sirpa UTSW 2 129609203 nonsense probably null
Z1088:Sirpa UTSW 2 129618535 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCGACCGTTCTGAACTGCAC -3'
(R):5'- GATCATGAACCTGACCTCCC -3'

Sequencing Primer
(F):5'- GACCGTTCTGAACTGCACTTTGAC -3'
(R):5'- ATTATACCTGCTGCGAGCCAC -3'
Posted On2019-10-24