Mutagenetix > Incidental Mutations

Incidental Mutation 'R7602:Sirpa'

588044

Institutional Source

Beutler Lab

Gene Symbol

Sirpa

Ensembl Gene

ENSMUSG00000037902

Gene Name

signal-regulatory protein alpha

Synonyms

SIRP, Ptpns1, CD172a, P84, SHPS-1, Bit

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7602 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

129592835-129632228 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 129609152 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Phenylalanine at position 111 (V111F)

Ref Sequence

ENSEMBL: ENSMUSP00000049022 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000049262] [ENSMUST00000099113] [ENSMUST00000103202] [ENSMUST00000103203] [ENSMUST00000153491] [ENSMUST00000160276] [ENSMUST00000161620] [ENSMUST00000163034] [ENSMUST00000179001]

Predicted Effect

probably damaging
Transcript: ENSMUST00000049262
AA Change: V111F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000049022
Gene: ENSMUSG00000037902
AA Change: V111F

Domain	Start	End	E-Value	Type
signal peptide	1	31	N/A	INTRINSIC
IG	40	146	1.78e-9	SMART
IGc1	166	239	5.4e-4	SMART
IGc1	269	342	8.51e-7	SMART
transmembrane domain	374	396	N/A	INTRINSIC
low complexity region	446	458	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000099113
AA Change: V111F

SMART Domains

Protein: ENSMUSP00000096713
Gene: ENSMUSG00000037902
AA Change: V111F

Domain	Start	End	E-Value	Type
signal peptide	1	31	N/A	INTRINSIC
IG	40	146	1.78e-9	SMART
transmembrane domain	156	178	N/A	INTRINSIC
low complexity region	228	240	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000103202
AA Change: V111F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000099491
Gene: ENSMUSG00000037902
AA Change: V111F

Domain	Start	End	E-Value	Type
signal peptide	1	31	N/A	INTRINSIC
IG	40	146	1.78e-9	SMART
IGc1	166	239	5.4e-4	SMART
IGc1	269	342	8.51e-7	SMART
transmembrane domain	374	396	N/A	INTRINSIC
low complexity region	442	454	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000103203
AA Change: V111F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000099492
Gene: ENSMUSG00000037902
AA Change: V111F

Domain	Start	End	E-Value	Type
signal peptide	1	31	N/A	INTRINSIC
IG	40	146	1.78e-9	SMART
IGc1	166	239	5.4e-4	SMART
IGc1	269	342	8.51e-7	SMART
transmembrane domain	374	396	N/A	INTRINSIC
low complexity region	442	454	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000153491
AA Change: V111F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000120324
Gene: ENSMUSG00000037902
AA Change: V111F

Domain	Start	End	E-Value	Type
signal peptide	1	31	N/A	INTRINSIC
IG	40	146	1.78e-9	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000160276
AA Change: V111F

PolyPhen 2 Score 0.818 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000125004
Gene: ENSMUSG00000037902
AA Change: V111F

Domain	Start	End	E-Value	Type
signal peptide	1	31	N/A	INTRINSIC
IG	40	146	1.78e-9	SMART
transmembrane domain	156	178	N/A	INTRINSIC
low complexity region	224	236	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000161620
AA Change: V111F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000124048
Gene: ENSMUSG00000037902
AA Change: V111F

Domain	Start	End	E-Value	Type
signal peptide	1	31	N/A	INTRINSIC
IG	40	146	1.78e-9	SMART
IGc1	166	239	5.4e-4	SMART
IGc1	269	342	8.51e-7	SMART
transmembrane domain	374	396	N/A	INTRINSIC
low complexity region	446	458	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000163034

SMART Domains

Protein: ENSMUSP00000124888
Gene: ENSMUSG00000037902

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
transmembrane domain	37	59	N/A	INTRINSIC
low complexity region	105	117	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000179001
AA Change: V111F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000137611
Gene: ENSMUSG00000037902
AA Change: V111F

Domain	Start	End	E-Value	Type
signal peptide	1	31	N/A	INTRINSIC
IG	40	146	1.78e-9	SMART
IGc1	166	239	5.4e-4	SMART
IGc1	269	342	8.51e-7	SMART
transmembrane domain	374	396	N/A	INTRINSIC
low complexity region	442	454	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.2%

Validation Efficiency

100% (58/58)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the signal-regulatory-protein (SIRP) family, and also belongs to the immunoglobulin superfamily. SIRP family members are receptor-type transmembrane glycoproteins known to be involved in the negative regulation of receptor tyrosine kinase-coupled signaling processes. This protein can be phosphorylated by tyrosine kinases. The phospho-tyrosine residues of this PTP have been shown to recruit SH2 domain containing tyrosine phosphatases (PTP), and serve as substrates of PTPs. This protein was found to participate in signal transduction mediated by various growth factor receptors. CD47 has been demonstrated to be a ligand for this receptor protein. This gene and its product share very high similarity with several other members of the SIRP family. These related genes are located in close proximity to each other on chromosome 20p13. Multiple alternatively spliced transcript variants have been determined for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display mild thrombocytopenia, fatty livers, decreased body weight, decreased proportion of single positive T cells, enhanced peritoneal macrophage phagocytosis and impaired Langerhans cell migration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700023F06Rik	T	C	11: 103,200,178	M114V	probably benign	Het
1700025G04Rik	A	T	1: 151,980,515	Y34N	probably damaging	Het
5730559C18Rik	G	T	1: 136,225,397	C252*	probably null	Het
A2m	T	C	6: 121,642,007	V237A	probably damaging	Het
A2m	A	T	6: 121,670,936	D1129V	possibly damaging	Het
Abca7	A	G	10: 79,998,012		probably null	Het
Ap3m2	T	C	8: 22,792,754	N256S	probably benign	Het
Atr	C	T	9: 95,907,383	H1531Y	possibly damaging	Het
Carmil3	C	T	14: 55,501,508	A873V	probably null	Het
Casp8	A	C	1: 58,833,739	K258T	probably benign	Het
Cast	A	G	13: 74,736,965	S222P	probably benign	Het
Cpsf7	C	T	19: 10,535,373	P274S	probably damaging	Het
Ddx24	A	T	12: 103,416,260	L688*	probably null	Het
Ddx59	A	G	1: 136,433,821	I475V	probably benign	Het
Dhx29	T	A	13: 112,944,559	S376T	possibly damaging	Het
Dhx57	G	T	17: 80,274,861	N438K	probably benign	Het
Dlk1	T	A	12: 109,455,625		probably null	Het
Epha6	T	C	16: 59,775,568	D920G	probably damaging	Het
Exo5	A	T	4: 120,921,621	V349E	probably benign	Het
Fam234b	T	C	6: 135,225,243	V321A	possibly damaging	Het
Gbp3	A	G	3: 142,569,061	E383G	probably benign	Het
Gga2	T	C	7: 121,997,330	N408S	probably benign	Het
Gm5346	C	T	8: 43,626,666	G174R	probably damaging	Het
Gm8298	T	C	3: 59,877,276	I390T	probably benign	Het
Gse1	T	C	8: 120,569,304	V532A	unknown	Het
Hnrnpul2	T	C	19: 8,831,309	Y712H	probably damaging	Het
Hpca	T	C	4: 129,120,226		probably benign	Het
Ifitm3	A	G	7: 141,010,459	F63L	probably damaging	Het
Kank1	A	T	19: 25,422,161	T940S	probably benign	Het
Klhl9	C	A	4: 88,722,409		probably benign	Het
Krt36	T	C	11: 100,102,960	M351V	probably benign	Het
Mthfd2	T	C	6: 83,311,848	N125D	probably benign	Het
Muc4	C	G	16: 32,753,930	Q1269E	probably benign	Het
Ncoa2	A	G	1: 13,177,126	S358P	possibly damaging	Het
Nmnat1	T	C	4: 149,473,351	H78R	probably benign	Het
Olfr1026	A	T	2: 85,923,802	Y178F	probably damaging	Het
Olfr173	T	C	16: 58,796,980	I289V	possibly damaging	Het
Olfr823	A	G	10: 130,112,310	M160T	probably benign	Het
Olfr982	T	G	9: 40,075,159	L288R	probably damaging	Het
Pabpc4	A	T	4: 123,292,892	D302V	possibly damaging	Het
Pgap1	A	T	1: 54,543,186	S167R	probably damaging	Het
Phf12	T	C	11: 78,023,283	L517P	probably benign	Het
Rcan2	A	G	17: 44,017,798	D86G	probably benign	Het
Ryk	T	C	9: 102,898,516	Y442H	probably damaging	Het
Scfd2	G	T	5: 74,462,610	Q421K	probably benign	Het
Skint4	A	T	4: 112,118,271	T143S	possibly damaging	Het
Slc12a8	C	A	16: 33,625,124	H463N	probably benign	Het
Sp110	G	A	1: 85,579,092	R417C		Het
Sptlc2	A	G	12: 87,341,689	Y340H	probably damaging	Het
Ssc5d	T	A	7: 4,942,746	W926R	possibly damaging	Het
Tgfa	A	G	6: 86,269,962	E82G	probably damaging	Het
Thrsp	A	G	7: 97,417,307	I66T	probably damaging	Het
Ttn	T	C	2: 76,851,644	E1003G	unknown	Het
Tube1	A	T	10: 39,142,266	H113L	probably benign	Het
Uri1	A	G	7: 37,981,628	V117A	probably benign	Het
Ush2a	G	A	1: 188,648,409	C2305Y	probably damaging	Het
Zbtb7a	T	G	10: 81,144,176	V68G	probably damaging	Het
Zfr	T	A	15: 12,159,677	D686E	possibly damaging	Het
Zscan4f	G	A	7: 11,401,381	S238N	possibly damaging	Het

Other mutations in Sirpa

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00835:Sirpa	APN	2	129609183	missense	probably damaging	1.00
IGL01138:Sirpa	APN	2	129630165	missense	probably damaging	1.00
IGL01835:Sirpa	APN	2	129615564	missense	possibly damaging	0.76
IGL02558:Sirpa	APN	2	129630069	missense	probably damaging	1.00
IGL02825:Sirpa	APN	2	129615452	missense	probably damaging	0.99
IGL03083:Sirpa	APN	2	129629928	missense	probably damaging	1.00
R0234:Sirpa	UTSW	2	129615468	missense	probably damaging	0.99
R0234:Sirpa	UTSW	2	129615468	missense	probably damaging	0.99
R0831:Sirpa	UTSW	2	129627936	splice site	probably benign
R1550:Sirpa	UTSW	2	129630041	missense	probably damaging	1.00
R1772:Sirpa	UTSW	2	129616456	missense	probably damaging	0.99
R1806:Sirpa	UTSW	2	129615512	missense	probably damaging	1.00
R1927:Sirpa	UTSW	2	129616376	missense	possibly damaging	0.46
R2568:Sirpa	UTSW	2	129615648	missense	probably benign	0.02
R4849:Sirpa	UTSW	2	129609243	missense	probably damaging	1.00
R5182:Sirpa	UTSW	2	129615732	missense	possibly damaging	0.65
R5673:Sirpa	UTSW	2	129630102	missense	probably damaging	1.00
R5680:Sirpa	UTSW	2	129616252	missense	probably benign	0.02
R6521:Sirpa	UTSW	2	129630155	missense	probably damaging	1.00
R6821:Sirpa	UTSW	2	129630097	missense	probably damaging	1.00
R7637:Sirpa	UTSW	2	129616445	missense	probably benign	0.44
R8311:Sirpa	UTSW	2	129616223	missense	probably damaging	1.00
RF018:Sirpa	UTSW	2	129609203	nonsense	probably null
RF049:Sirpa	UTSW	2	129609203	nonsense	probably null
Z1088:Sirpa	UTSW	2	129618535	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCGACCGTTCTGAACTGCAC -3'
(R):5'- GATCATGAACCTGACCTCCC -3'

Sequencing Primer
(F):5'- GACCGTTCTGAACTGCACTTTGAC -3'
(R):5'- ATTATACCTGCTGCGAGCCAC -3'

Posted On

2019-10-24