Incidental Mutation 'R7602:Klhl9'
ID588048
Institutional Source Beutler Lab
Gene Symbol Klhl9
Ensembl Gene ENSMUSG00000070923
Gene Namekelch-like 9
SynonymsC530050O22Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7602 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location88718292-88722465 bp(-) (GRCm38)
Type of Mutationstart gained
DNA Base Change (assembly) C to A at 88722409 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000092602 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094993] [ENSMUST00000181601]
Predicted Effect probably benign
Transcript: ENSMUST00000094993
SMART Domains Protein: ENSMUSP00000092602
Gene: ENSMUSG00000070923

DomainStartEndE-ValueType
BTB 50 149 7.21e-22 SMART
BACK 154 255 3.93e-27 SMART
low complexity region 276 287 N/A INTRINSIC
Kelch 299 347 1.13e-2 SMART
Kelch 348 399 1.92e-5 SMART
Kelch 400 446 1.59e-11 SMART
Kelch 447 493 2.61e-7 SMART
Kelch 494 545 1.58e-6 SMART
Kelch 546 594 1.43e-1 SMART
Predicted Effect silent
Transcript: ENSMUST00000181601
SMART Domains Protein: ENSMUSP00000137773
Gene: ENSMUSG00000097078

DomainStartEndE-ValueType
low complexity region 121 133 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the kelch repeat-containing family, and contains an N-terminal BTB/POZ domain, a BACK domain and six C-terminal kelch repeats. The encoded protein is a component of a complex with cullin 3-based E3 ligase, which plays a role in mitosis. This protein complex is a cell cycle regulator, and functions in the organization and integrity of the spindle midzone in anaphase and the completion of cytokinesis. The complex is required for the removal of the chromosomal passenger protein aurora B from mitotic chromosomes. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700023F06Rik T C 11: 103,200,178 M114V probably benign Het
1700025G04Rik A T 1: 151,980,515 Y34N probably damaging Het
5730559C18Rik G T 1: 136,225,397 C252* probably null Het
A2m T C 6: 121,642,007 V237A probably damaging Het
A2m A T 6: 121,670,936 D1129V possibly damaging Het
Abca7 A G 10: 79,998,012 probably null Het
Ap3m2 T C 8: 22,792,754 N256S probably benign Het
Atr C T 9: 95,907,383 H1531Y possibly damaging Het
Carmil3 C T 14: 55,501,508 A873V probably null Het
Casp8 A C 1: 58,833,739 K258T probably benign Het
Cast A G 13: 74,736,965 S222P probably benign Het
Cpsf7 C T 19: 10,535,373 P274S probably damaging Het
Ddx24 A T 12: 103,416,260 L688* probably null Het
Ddx59 A G 1: 136,433,821 I475V probably benign Het
Dhx29 T A 13: 112,944,559 S376T possibly damaging Het
Dhx57 G T 17: 80,274,861 N438K probably benign Het
Dlk1 T A 12: 109,455,625 probably null Het
Epha6 T C 16: 59,775,568 D920G probably damaging Het
Exo5 A T 4: 120,921,621 V349E probably benign Het
Fam234b T C 6: 135,225,243 V321A possibly damaging Het
Gbp3 A G 3: 142,569,061 E383G probably benign Het
Gga2 T C 7: 121,997,330 N408S probably benign Het
Gm5346 C T 8: 43,626,666 G174R probably damaging Het
Gm8298 T C 3: 59,877,276 I390T probably benign Het
Gse1 T C 8: 120,569,304 V532A unknown Het
Hnrnpul2 T C 19: 8,831,309 Y712H probably damaging Het
Hpca T C 4: 129,120,226 probably benign Het
Ifitm3 A G 7: 141,010,459 F63L probably damaging Het
Kank1 A T 19: 25,422,161 T940S probably benign Het
Krt36 T C 11: 100,102,960 M351V probably benign Het
Mthfd2 T C 6: 83,311,848 N125D probably benign Het
Muc4 C G 16: 32,753,930 Q1269E probably benign Het
Ncoa2 A G 1: 13,177,126 S358P possibly damaging Het
Nmnat1 T C 4: 149,473,351 H78R probably benign Het
Olfr1026 A T 2: 85,923,802 Y178F probably damaging Het
Olfr173 T C 16: 58,796,980 I289V possibly damaging Het
Olfr823 A G 10: 130,112,310 M160T probably benign Het
Olfr982 T G 9: 40,075,159 L288R probably damaging Het
Pabpc4 A T 4: 123,292,892 D302V possibly damaging Het
Pgap1 A T 1: 54,543,186 S167R probably damaging Het
Phf12 T C 11: 78,023,283 L517P probably benign Het
Rcan2 A G 17: 44,017,798 D86G probably benign Het
Ryk T C 9: 102,898,516 Y442H probably damaging Het
Scfd2 G T 5: 74,462,610 Q421K probably benign Het
Sec24b CTGGTG CTGGTGGTG 3: 130,040,837 probably benign Het
Sirpa G T 2: 129,609,152 V111F probably damaging Het
Skint4 A T 4: 112,118,271 T143S possibly damaging Het
Slc12a8 C A 16: 33,625,124 H463N probably benign Het
Sp110 G A 1: 85,579,092 R417C Het
Sptlc2 A G 12: 87,341,689 Y340H probably damaging Het
Ssc5d T A 7: 4,942,746 W926R possibly damaging Het
Tgfa A G 6: 86,269,962 E82G probably damaging Het
Thrsp A G 7: 97,417,307 I66T probably damaging Het
Ttn T C 2: 76,851,644 E1003G unknown Het
Tube1 A T 10: 39,142,266 H113L probably benign Het
Uri1 A G 7: 37,981,628 V117A probably benign Het
Ush2a G A 1: 188,648,409 C2305Y probably damaging Het
Zbtb7a T G 10: 81,144,176 V68G probably damaging Het
Zfr T A 15: 12,159,677 D686E possibly damaging Het
Zscan4f G A 7: 11,401,381 S238N possibly damaging Het
Other mutations in Klhl9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00588:Klhl9 APN 4 88720819 missense probably damaging 1.00
IGL00592:Klhl9 APN 4 88721141 missense probably damaging 0.99
IGL01986:Klhl9 APN 4 88721779 missense probably damaging 0.99
IGL02364:Klhl9 APN 4 88721170 missense probably damaging 1.00
IGL02994:Klhl9 APN 4 88721197 nonsense probably null
minnow UTSW 4 88721606 nonsense probably null
R0319:Klhl9 UTSW 4 88720454 missense possibly damaging 0.91
R0360:Klhl9 UTSW 4 88720290 missense probably benign 0.05
R0364:Klhl9 UTSW 4 88720290 missense probably benign 0.05
R0693:Klhl9 UTSW 4 88720290 missense probably benign 0.05
R0961:Klhl9 UTSW 4 88721737 missense probably benign 0.16
R1521:Klhl9 UTSW 4 88721993 missense probably benign 0.03
R2891:Klhl9 UTSW 4 88720970 missense probably benign 0.02
R3762:Klhl9 UTSW 4 88721593 missense possibly damaging 0.93
R4584:Klhl9 UTSW 4 88721907 missense probably damaging 1.00
R4678:Klhl9 UTSW 4 88720924 missense probably damaging 1.00
R4888:Klhl9 UTSW 4 88721945 missense probably benign 0.01
R5030:Klhl9 UTSW 4 88720534 missense possibly damaging 0.96
R5082:Klhl9 UTSW 4 88721385 missense probably damaging 0.97
R6466:Klhl9 UTSW 4 88721162 missense probably benign 0.00
R7032:Klhl9 UTSW 4 88721606 nonsense probably null
R7532:Klhl9 UTSW 4 88720853 missense possibly damaging 0.79
R7618:Klhl9 UTSW 4 88720535 missense possibly damaging 0.80
R7879:Klhl9 UTSW 4 88720338 missense probably damaging 1.00
R7909:Klhl9 UTSW 4 88721001 missense probably benign 0.12
R7962:Klhl9 UTSW 4 88720338 missense probably damaging 1.00
R7990:Klhl9 UTSW 4 88721001 missense probably benign 0.12
X0063:Klhl9 UTSW 4 88721951 missense probably benign
Predicted Primers PCR Primer
(F):5'- CTCAAATCTGCCAGGAGAGC -3'
(R):5'- ACATAATGGACCCTGCACCG -3'

Sequencing Primer
(F):5'- GCAGTTACGTGACCGCTTC -3'
(R):5'- GACCCTGCACCGGCCTC -3'
Posted On2019-10-24