Incidental Mutation 'R7602:Skint4'
ID588049
Institutional Source Beutler Lab
Gene Symbol Skint4
Ensembl Gene ENSMUSG00000055960
Gene Nameselection and upkeep of intraepithelial T cells 4
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R7602 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location112072016-112168076 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 112118271 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 143 (T143S)
Ref Sequence ENSEMBL: ENSMUSP00000102176 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069769] [ENSMUST00000106564] [ENSMUST00000106565] [ENSMUST00000106566]
Predicted Effect probably damaging
Transcript: ENSMUST00000069769
AA Change: T135S

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000070676
Gene: ENSMUSG00000055960
AA Change: T135S

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
IG 33 140 7.24e-10 SMART
Pfam:C2-set_2 141 227 6.2e-8 PFAM
transmembrane domain 242 264 N/A INTRINSIC
transmembrane domain 296 318 N/A INTRINSIC
transmembrane domain 342 364 N/A INTRINSIC
transmembrane domain 383 405 N/A INTRINSIC
transmembrane domain 425 447 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106564
AA Change: T135S

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000102174
Gene: ENSMUSG00000055960
AA Change: T135S

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
IG 33 140 7.24e-10 SMART
Pfam:C2-set_2 141 227 6.2e-8 PFAM
transmembrane domain 242 264 N/A INTRINSIC
transmembrane domain 296 318 N/A INTRINSIC
transmembrane domain 342 364 N/A INTRINSIC
transmembrane domain 383 405 N/A INTRINSIC
transmembrane domain 425 447 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106565
AA Change: T135S

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000102175
Gene: ENSMUSG00000055960
AA Change: T135S

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
IG 33 140 7.24e-10 SMART
Pfam:C2-set_2 141 227 6.2e-8 PFAM
transmembrane domain 242 264 N/A INTRINSIC
transmembrane domain 296 318 N/A INTRINSIC
transmembrane domain 342 364 N/A INTRINSIC
transmembrane domain 383 405 N/A INTRINSIC
transmembrane domain 425 447 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000106566
AA Change: T143S

PolyPhen 2 Score 0.500 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000102176
Gene: ENSMUSG00000055960
AA Change: T143S

DomainStartEndE-ValueType
IG 41 148 7.24e-10 SMART
transmembrane domain 250 272 N/A INTRINSIC
transmembrane domain 304 326 N/A INTRINSIC
transmembrane domain 350 372 N/A INTRINSIC
transmembrane domain 391 413 N/A INTRINSIC
transmembrane domain 433 455 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (58/58)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700023F06Rik T C 11: 103,200,178 M114V probably benign Het
1700025G04Rik A T 1: 151,980,515 Y34N probably damaging Het
5730559C18Rik G T 1: 136,225,397 C252* probably null Het
A2m T C 6: 121,642,007 V237A probably damaging Het
A2m A T 6: 121,670,936 D1129V possibly damaging Het
Abca7 A G 10: 79,998,012 probably null Het
Ap3m2 T C 8: 22,792,754 N256S probably benign Het
Atr C T 9: 95,907,383 H1531Y possibly damaging Het
Carmil3 C T 14: 55,501,508 A873V probably null Het
Casp8 A C 1: 58,833,739 K258T probably benign Het
Cast A G 13: 74,736,965 S222P probably benign Het
Cpsf7 C T 19: 10,535,373 P274S probably damaging Het
Ddx24 A T 12: 103,416,260 L688* probably null Het
Ddx59 A G 1: 136,433,821 I475V probably benign Het
Dhx29 T A 13: 112,944,559 S376T possibly damaging Het
Dhx57 G T 17: 80,274,861 N438K probably benign Het
Dlk1 T A 12: 109,455,625 probably null Het
Epha6 T C 16: 59,775,568 D920G probably damaging Het
Exo5 A T 4: 120,921,621 V349E probably benign Het
Fam234b T C 6: 135,225,243 V321A possibly damaging Het
Gbp3 A G 3: 142,569,061 E383G probably benign Het
Gga2 T C 7: 121,997,330 N408S probably benign Het
Gm5346 C T 8: 43,626,666 G174R probably damaging Het
Gm8298 T C 3: 59,877,276 I390T probably benign Het
Gse1 T C 8: 120,569,304 V532A unknown Het
Hnrnpul2 T C 19: 8,831,309 Y712H probably damaging Het
Hpca T C 4: 129,120,226 probably benign Het
Ifitm3 A G 7: 141,010,459 F63L probably damaging Het
Kank1 A T 19: 25,422,161 T940S probably benign Het
Klhl9 C A 4: 88,722,409 probably benign Het
Krt36 T C 11: 100,102,960 M351V probably benign Het
Mthfd2 T C 6: 83,311,848 N125D probably benign Het
Muc4 C G 16: 32,753,930 Q1269E probably benign Het
Ncoa2 A G 1: 13,177,126 S358P possibly damaging Het
Nmnat1 T C 4: 149,473,351 H78R probably benign Het
Olfr1026 A T 2: 85,923,802 Y178F probably damaging Het
Olfr173 T C 16: 58,796,980 I289V possibly damaging Het
Olfr823 A G 10: 130,112,310 M160T probably benign Het
Olfr982 T G 9: 40,075,159 L288R probably damaging Het
Pabpc4 A T 4: 123,292,892 D302V possibly damaging Het
Pgap1 A T 1: 54,543,186 S167R probably damaging Het
Phf12 T C 11: 78,023,283 L517P probably benign Het
Rcan2 A G 17: 44,017,798 D86G probably benign Het
Ryk T C 9: 102,898,516 Y442H probably damaging Het
Scfd2 G T 5: 74,462,610 Q421K probably benign Het
Sirpa G T 2: 129,609,152 V111F probably damaging Het
Slc12a8 C A 16: 33,625,124 H463N probably benign Het
Sp110 G A 1: 85,579,092 R417C Het
Sptlc2 A G 12: 87,341,689 Y340H probably damaging Het
Ssc5d T A 7: 4,942,746 W926R possibly damaging Het
Tgfa A G 6: 86,269,962 E82G probably damaging Het
Thrsp A G 7: 97,417,307 I66T probably damaging Het
Ttn T C 2: 76,851,644 E1003G unknown Het
Tube1 A T 10: 39,142,266 H113L probably benign Het
Uri1 A G 7: 37,981,628 V117A probably benign Het
Ush2a G A 1: 188,648,409 C2305Y probably damaging Het
Zbtb7a T G 10: 81,144,176 V68G probably damaging Het
Zfr T A 15: 12,159,677 D686E possibly damaging Het
Zscan4f G A 7: 11,401,381 S238N possibly damaging Het
Other mutations in Skint4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01397:Skint4 APN 4 112120010 missense possibly damaging 0.86
IGL01654:Skint4 APN 4 112120057 missense probably damaging 0.99
IGL02040:Skint4 APN 4 112146482 splice site probably benign
IGL02328:Skint4 APN 4 112120058 missense possibly damaging 0.92
IGL02811:Skint4 APN 4 112087003 missense possibly damaging 0.86
IGL02965:Skint4 APN 4 112136021 missense probably benign 0.01
IGL03039:Skint4 APN 4 112124650 missense probably benign 0.20
IGL03060:Skint4 APN 4 112118235 missense probably benign 0.33
IGL03075:Skint4 APN 4 112087042 missense probably damaging 1.00
IGL03352:Skint4 APN 4 112165686 missense possibly damaging 0.96
PIT4378001:Skint4 UTSW 4 112087035 missense probably benign 0.01
R0483:Skint4 UTSW 4 112117939 splice site probably benign
R1175:Skint4 UTSW 4 112124596 missense probably benign 0.14
R1446:Skint4 UTSW 4 112118114 missense probably benign 0.11
R1641:Skint4 UTSW 4 112136043 missense possibly damaging 0.93
R1983:Skint4 UTSW 4 112146492 missense probably benign 0.00
R2168:Skint4 UTSW 4 112086986 critical splice acceptor site probably null
R2272:Skint4 UTSW 4 112119868 missense probably benign 0.01
R2287:Skint4 UTSW 4 112118205 missense possibly damaging 0.70
R3801:Skint4 UTSW 4 112118181 missense probably damaging 0.98
R3802:Skint4 UTSW 4 112118181 missense probably damaging 0.98
R3804:Skint4 UTSW 4 112118181 missense probably damaging 0.98
R4009:Skint4 UTSW 4 112120109 missense possibly damaging 0.70
R4050:Skint4 UTSW 4 112124614 missense probably benign 0.01
R4564:Skint4 UTSW 4 112119869 missense probably damaging 0.99
R4581:Skint4 UTSW 4 112087042 missense probably damaging 1.00
R4587:Skint4 UTSW 4 112087024 missense probably damaging 0.99
R4674:Skint4 UTSW 4 112118233 missense probably damaging 1.00
R4723:Skint4 UTSW 4 112118236 missense possibly damaging 0.70
R4753:Skint4 UTSW 4 112146531 missense probably benign 0.00
R4775:Skint4 UTSW 4 112136064 missense probably damaging 0.97
R4832:Skint4 UTSW 4 112143766 missense possibly damaging 0.49
R5299:Skint4 UTSW 4 112136006 missense possibly damaging 0.59
R6118:Skint4 UTSW 4 112119822 splice site probably null
R6433:Skint4 UTSW 4 112146510 missense probably benign 0.00
R6616:Skint4 UTSW 4 112118230 missense possibly damaging 0.70
R6698:Skint4 UTSW 4 112119899 missense probably damaging 1.00
R6752:Skint4 UTSW 4 112119863 missense possibly damaging 0.89
R7034:Skint4 UTSW 4 112158084 missense possibly damaging 0.53
R7102:Skint4 UTSW 4 112118101 missense probably damaging 1.00
R8027:Skint4 UTSW 4 112157985 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- ACCTGTGCACCTATACCGTAATG -3'
(R):5'- TGGAAAACTTCTAAAGTGCTGTCAG -3'

Sequencing Primer
(F):5'- CCGTAATGGTAAAAACCTACATGG -3'
(R):5'- AGTGCTGTCAGAAATAATTGACAAG -3'
Posted On2019-10-24