Incidental Mutation 'R7602:Hpca'
ID588052
Institutional Source Beutler Lab
Gene Symbol Hpca
Ensembl Gene ENSMUSG00000028785
Gene Namehippocalcin
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.164) question?
Stock #R7602 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location129111570-129122036 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to C at 129120226 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000129548 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030572] [ENSMUST00000095807] [ENSMUST00000116442] [ENSMUST00000116444] [ENSMUST00000125931] [ENSMUST00000135763] [ENSMUST00000139450] [ENSMUST00000149763] [ENSMUST00000164649]
Predicted Effect probably benign
Transcript: ENSMUST00000030572
SMART Domains Protein: ENSMUSP00000030572
Gene: ENSMUSG00000028785

DomainStartEndE-ValueType
EFh 64 92 2.37e-3 SMART
EFh 100 128 3.1e-7 SMART
EFh 148 176 1.29e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000095807
SMART Domains Protein: ENSMUSP00000093486
Gene: ENSMUSG00000028785

DomainStartEndE-ValueType
EFh 64 92 2.37e-3 SMART
EFh 100 128 3.1e-7 SMART
EFh 148 176 1.29e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000116442
SMART Domains Protein: ENSMUSP00000112143
Gene: ENSMUSG00000028785

DomainStartEndE-ValueType
EFh 64 92 2.37e-3 SMART
EFh 100 128 3.1e-7 SMART
EFh 148 176 1.29e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000116444
SMART Domains Protein: ENSMUSP00000112145
Gene: ENSMUSG00000028785

DomainStartEndE-ValueType
EFh 64 92 2.37e-3 SMART
EFh 100 128 3.1e-7 SMART
EFh 148 176 1.29e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125931
SMART Domains Protein: ENSMUSP00000115031
Gene: ENSMUSG00000028785

DomainStartEndE-ValueType
EFh 64 92 2.37e-3 SMART
EFh 100 128 3.1e-7 SMART
EFh 148 176 1.29e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135763
Predicted Effect probably benign
Transcript: ENSMUST00000139450
SMART Domains Protein: ENSMUSP00000119178
Gene: ENSMUSG00000028785

DomainStartEndE-ValueType
EFh 64 92 2.37e-3 SMART
EFh 100 128 3.1e-7 SMART
EFh 148 176 1.29e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000149763
SMART Domains Protein: ENSMUSP00000115619
Gene: ENSMUSG00000028785

DomainStartEndE-ValueType
EFh 64 92 2.37e-3 SMART
EFh 100 128 3.1e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000164649
SMART Domains Protein: ENSMUSP00000129548
Gene: ENSMUSG00000028785

DomainStartEndE-ValueType
EFh 64 92 2.37e-3 SMART
EFh 100 128 3.1e-7 SMART
EFh 148 176 1.29e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of neuron-specific calcium-binding proteins family found in the retina and brain. This protein is associated with the plasma membrane. It has similarities to proteins located in the photoreceptor cells that regulate photosignal transduction in a calcium-sensitive manner. This protein displays recoverin activity and a calcium-dependent inhibition of rhodopsin kinase. It is identical to the rat and mouse hippocalcin proteins and thought to play an important role in neurons of the central nervous system in a number of species. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice exhibit an age-dependent increase in neurodegeneration in the hippocampus and the cortex. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700023F06Rik T C 11: 103,200,178 M114V probably benign Het
1700025G04Rik A T 1: 151,980,515 Y34N probably damaging Het
5730559C18Rik G T 1: 136,225,397 C252* probably null Het
A2m T C 6: 121,642,007 V237A probably damaging Het
A2m A T 6: 121,670,936 D1129V possibly damaging Het
Abca7 A G 10: 79,998,012 probably null Het
Ap3m2 T C 8: 22,792,754 N256S probably benign Het
Atr C T 9: 95,907,383 H1531Y possibly damaging Het
Carmil3 C T 14: 55,501,508 A873V probably null Het
Casp8 A C 1: 58,833,739 K258T probably benign Het
Cast A G 13: 74,736,965 S222P probably benign Het
Cpsf7 C T 19: 10,535,373 P274S probably damaging Het
Ddx24 A T 12: 103,416,260 L688* probably null Het
Ddx59 A G 1: 136,433,821 I475V probably benign Het
Dhx29 T A 13: 112,944,559 S376T possibly damaging Het
Dhx57 G T 17: 80,274,861 N438K probably benign Het
Dlk1 T A 12: 109,455,625 probably null Het
Epha6 T C 16: 59,775,568 D920G probably damaging Het
Exo5 A T 4: 120,921,621 V349E probably benign Het
Fam234b T C 6: 135,225,243 V321A possibly damaging Het
Gbp3 A G 3: 142,569,061 E383G probably benign Het
Gga2 T C 7: 121,997,330 N408S probably benign Het
Gm5346 C T 8: 43,626,666 G174R probably damaging Het
Gm8298 T C 3: 59,877,276 I390T probably benign Het
Gse1 T C 8: 120,569,304 V532A unknown Het
Hnrnpul2 T C 19: 8,831,309 Y712H probably damaging Het
Ifitm3 A G 7: 141,010,459 F63L probably damaging Het
Kank1 A T 19: 25,422,161 T940S probably benign Het
Klhl9 C A 4: 88,722,409 probably benign Het
Krt36 T C 11: 100,102,960 M351V probably benign Het
Mthfd2 T C 6: 83,311,848 N125D probably benign Het
Muc4 C G 16: 32,753,930 Q1269E probably benign Het
Ncoa2 A G 1: 13,177,126 S358P possibly damaging Het
Nmnat1 T C 4: 149,473,351 H78R probably benign Het
Olfr1026 A T 2: 85,923,802 Y178F probably damaging Het
Olfr173 T C 16: 58,796,980 I289V possibly damaging Het
Olfr823 A G 10: 130,112,310 M160T probably benign Het
Olfr982 T G 9: 40,075,159 L288R probably damaging Het
Pabpc4 A T 4: 123,292,892 D302V possibly damaging Het
Pgap1 A T 1: 54,543,186 S167R probably damaging Het
Phf12 T C 11: 78,023,283 L517P probably benign Het
Rcan2 A G 17: 44,017,798 D86G probably benign Het
Ryk T C 9: 102,898,516 Y442H probably damaging Het
Scfd2 G T 5: 74,462,610 Q421K probably benign Het
Sirpa G T 2: 129,609,152 V111F probably damaging Het
Skint4 A T 4: 112,118,271 T143S possibly damaging Het
Slc12a8 C A 16: 33,625,124 H463N probably benign Het
Sp110 G A 1: 85,579,092 R417C Het
Sptlc2 A G 12: 87,341,689 Y340H probably damaging Het
Ssc5d T A 7: 4,942,746 W926R possibly damaging Het
Tgfa A G 6: 86,269,962 E82G probably damaging Het
Thrsp A G 7: 97,417,307 I66T probably damaging Het
Ttn T C 2: 76,851,644 E1003G unknown Het
Tube1 A T 10: 39,142,266 H113L probably benign Het
Uri1 A G 7: 37,981,628 V117A probably benign Het
Ush2a G A 1: 188,648,409 C2305Y probably damaging Het
Zbtb7a T G 10: 81,144,176 V68G probably damaging Het
Zfr T A 15: 12,159,677 D686E possibly damaging Het
Zscan4f G A 7: 11,401,381 S238N possibly damaging Het
Other mutations in Hpca
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02523:Hpca APN 4 129118575 missense probably damaging 1.00
IGL02893:Hpca APN 4 129118422 missense probably damaging 1.00
IGL03083:Hpca APN 4 129118526 missense probably damaging 1.00
IGL03165:Hpca APN 4 129118590 missense probably damaging 1.00
R1840:Hpca UTSW 4 129118600 missense probably damaging 1.00
R2147:Hpca UTSW 4 129118485 missense possibly damaging 0.86
R2372:Hpca UTSW 4 129118444 nonsense probably null
R6265:Hpca UTSW 4 129118652 nonsense probably null
R7237:Hpca UTSW 4 129118614 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGGCACCCTTGTCATTTG -3'
(R):5'- CCACATCATGGGTGAGCATACG -3'

Sequencing Primer
(F):5'- TATCCCCGAGGTGCTGTCAG -3'
(R):5'- GTGAGCATACGCATTCAACATG -3'
Posted On2019-10-24