Incidental Mutation 'R7602:Tgfa'
ID588056
Institutional Source Beutler Lab
Gene Symbol Tgfa
Ensembl Gene ENSMUSG00000029999
Gene Nametransforming growth factor alpha
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7602 (G1)
Quality Score217.009
Status Validated
Chromosome6
Chromosomal Location86195223-86275719 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 86269962 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 82 (E82G)
Ref Sequence ENSEMBL: ENSMUSP00000032066 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032066] [ENSMUST00000192058]
Predicted Effect probably damaging
Transcript: ENSMUST00000032066
AA Change: E82G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000032066
Gene: ENSMUSG00000029999
AA Change: E82G

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
EGF 45 82 1.01e-1 SMART
transmembrane domain 98 120 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192058
SMART Domains Protein: ENSMUSP00000141395
Gene: ENSMUSG00000029999

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
PDB:4TGF|A 39 71 4e-17 PDB
SCOP:d1ioxa_ 42 71 8e-11 SMART
Blast:EGF 45 71 1e-12 BLAST
Meta Mutation Damage Score 0.7865 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: This gene encodes a member of the epidermal growth factor (EGF) family of proteins that regulate cellular proliferation. The encoded protein undergoes proteolytic processing to generate a soluble glycoprotein that is secreted by the cell. The secreted protein binds to the EGF receptors to initiate signaling events resulting in cellular proliferation, mucous production or inhibition of gastric acid secretion. The transgenic expression of the encoded protein in mice induces the development of cancers in various tissues such as liver, pancreas, skin and mammary glands. Mice lacking the encoded protein exhibit a wavy coat and curly whiskers phenotype as well as abnormalities in the eye. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous mutants have curly vibrissae, wavy hair with misaligned hair follicles, reduced body weight, and eye defects including open eyelids at birth, corneal scarring and microphthalmia. Some heterozygotes show mild forms of the eye abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700023F06Rik T C 11: 103,200,178 M114V probably benign Het
1700025G04Rik A T 1: 151,980,515 Y34N probably damaging Het
5730559C18Rik G T 1: 136,225,397 C252* probably null Het
A2m T C 6: 121,642,007 V237A probably damaging Het
A2m A T 6: 121,670,936 D1129V possibly damaging Het
Abca7 A G 10: 79,998,012 probably null Het
Ap3m2 T C 8: 22,792,754 N256S probably benign Het
Atr C T 9: 95,907,383 H1531Y possibly damaging Het
Carmil3 C T 14: 55,501,508 A873V probably null Het
Casp8 A C 1: 58,833,739 K258T probably benign Het
Cast A G 13: 74,736,965 S222P probably benign Het
Cpsf7 C T 19: 10,535,373 P274S probably damaging Het
Ddx24 A T 12: 103,416,260 L688* probably null Het
Ddx59 A G 1: 136,433,821 I475V probably benign Het
Dhx29 T A 13: 112,944,559 S376T possibly damaging Het
Dhx57 G T 17: 80,274,861 N438K probably benign Het
Dlk1 T A 12: 109,455,625 probably null Het
Epha6 T C 16: 59,775,568 D920G probably damaging Het
Exo5 A T 4: 120,921,621 V349E probably benign Het
Fam234b T C 6: 135,225,243 V321A possibly damaging Het
Gbp3 A G 3: 142,569,061 E383G probably benign Het
Gga2 T C 7: 121,997,330 N408S probably benign Het
Gm5346 C T 8: 43,626,666 G174R probably damaging Het
Gm8298 T C 3: 59,877,276 I390T probably benign Het
Gse1 T C 8: 120,569,304 V532A unknown Het
Hnrnpul2 T C 19: 8,831,309 Y712H probably damaging Het
Hpca T C 4: 129,120,226 probably benign Het
Ifitm3 A G 7: 141,010,459 F63L probably damaging Het
Kank1 A T 19: 25,422,161 T940S probably benign Het
Klhl9 C A 4: 88,722,409 probably benign Het
Krt36 T C 11: 100,102,960 M351V probably benign Het
Mthfd2 T C 6: 83,311,848 N125D probably benign Het
Muc4 C G 16: 32,753,930 Q1269E probably benign Het
Ncoa2 A G 1: 13,177,126 S358P possibly damaging Het
Nmnat1 T C 4: 149,473,351 H78R probably benign Het
Olfr1026 A T 2: 85,923,802 Y178F probably damaging Het
Olfr173 T C 16: 58,796,980 I289V possibly damaging Het
Olfr823 A G 10: 130,112,310 M160T probably benign Het
Olfr982 T G 9: 40,075,159 L288R probably damaging Het
Pabpc4 A T 4: 123,292,892 D302V possibly damaging Het
Pgap1 A T 1: 54,543,186 S167R probably damaging Het
Phf12 T C 11: 78,023,283 L517P probably benign Het
Rcan2 A G 17: 44,017,798 D86G probably benign Het
Ryk T C 9: 102,898,516 Y442H probably damaging Het
Scfd2 G T 5: 74,462,610 Q421K probably benign Het
Sirpa G T 2: 129,609,152 V111F probably damaging Het
Skint4 A T 4: 112,118,271 T143S possibly damaging Het
Slc12a8 C A 16: 33,625,124 H463N probably benign Het
Sp110 G A 1: 85,579,092 R417C Het
Sptlc2 A G 12: 87,341,689 Y340H probably damaging Het
Ssc5d T A 7: 4,942,746 W926R possibly damaging Het
Thrsp A G 7: 97,417,307 I66T probably damaging Het
Ttn T C 2: 76,851,644 E1003G unknown Het
Tube1 A T 10: 39,142,266 H113L probably benign Het
Uri1 A G 7: 37,981,628 V117A probably benign Het
Ush2a G A 1: 188,648,409 C2305Y probably damaging Het
Zbtb7a T G 10: 81,144,176 V68G probably damaging Het
Zfr T A 15: 12,159,677 D686E possibly damaging Het
Zscan4f G A 7: 11,401,381 S238N possibly damaging Het
Other mutations in Tgfa
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03179:Tgfa APN 6 86271421 missense probably benign 0.01
R0745:Tgfa UTSW 6 86271435 missense probably damaging 0.99
R1109:Tgfa UTSW 6 86270090 intron probably benign
R5054:Tgfa UTSW 6 86270082 splice site probably null
Predicted Primers PCR Primer
(F):5'- AGCAGGGGATCAGTTTCCTC -3'
(R):5'- CCATACTTCAAATGCCCCTGG -3'

Sequencing Primer
(F):5'- CTCGGCAGGAGAGTAGACTCAC -3'
(R):5'- TGGCAGAGCAGGCAGGTG -3'
Posted On2019-10-24