Incidental Mutation 'R0624:Atp4a'
ID58806
Institutional Source Beutler Lab
Gene Symbol Atp4a
Ensembl Gene ENSMUSG00000005553
Gene NameATPase, H+/K+ exchanging, gastric, alpha polypeptide
SynonymsH+/K+-ATPase alpha, H+K+-transporting alpha 1
MMRRC Submission 038813-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.109) question?
Stock #R0624 (G1)
Quality Score178
Status Validated
Chromosome7
Chromosomal Location30712209-30725534 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 30718999 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 571 (N571D)
Ref Sequence ENSEMBL: ENSMUSP00000131964 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005692] [ENSMUST00000170371] [ENSMUST00000171014]
Predicted Effect probably benign
Transcript: ENSMUST00000005692
AA Change: N571D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000005692
Gene: ENSMUSG00000005553
AA Change: N571D

DomainStartEndE-ValueType
Pfam:H-K_ATPase_N 2 42 5.4e-23 PFAM
Cation_ATPase_N 52 126 2.26e-18 SMART
Pfam:E1-E2_ATPase 144 375 1.1e-57 PFAM
Pfam:Hydrolase 380 739 5.3e-16 PFAM
Pfam:HAD 383 736 1.9e-18 PFAM
Pfam:Cation_ATPase 436 531 1.6e-24 PFAM
Pfam:Cation_ATPase_C 809 1019 4.8e-43 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165410
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167761
Predicted Effect probably benign
Transcript: ENSMUST00000170371
AA Change: N571D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000131964
Gene: ENSMUSG00000005553
AA Change: N571D

DomainStartEndE-ValueType
Pfam:H-K_ATPase_N 2 42 4.9e-28 PFAM
Cation_ATPase_N 52 126 2.26e-18 SMART
Pfam:E1-E2_ATPase 145 376 1e-62 PFAM
Pfam:Hydrolase 380 730 9.3e-25 PFAM
Pfam:HAD 383 727 2.1e-15 PFAM
Pfam:Hydrolase_like2 436 531 4e-25 PFAM
Pfam:Cation_ATPase_C 800 1010 1.5e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171014
Meta Mutation Damage Score 0.0863 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.2%
Validation Efficiency 98% (88/90)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a family of P-type cation-transporting ATPases. The gastric H+, K+-ATPase is a heterodimer consisting of a high molecular weight catalytic alpha subunit and a smaller but heavily glycosylated beta subunit. This enzyme is a proton pump that catalyzes the hydrolysis of ATP coupled with the exchange of H(+) and K(+) ions across the plasma membrane. It is also responsible for gastric acid secretion. This gene encodes a catalytic alpha subunit of the gastric H+, K+-ATPase. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in achlorhydria, hypergastrinemia, and abnormalities of the parietal cells. Mice homozygous for an ENU-induced allele exhibit iron-deficiency anemia. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted, knock-out(1) Targeted, other(2)

Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik G A 11: 78,268,457 E494K probably damaging Het
Abca9 T A 11: 110,139,620 D767V probably damaging Het
Add1 T A 5: 34,605,853 N128K probably damaging Het
Ado A T 10: 67,548,228 D182E probably benign Het
Anapc4 T A 5: 52,845,419 probably benign Het
Ano10 A G 9: 122,259,595 probably benign Het
Apba2 A G 7: 64,714,515 probably null Het
Apc2 A G 10: 80,314,583 T1795A probably benign Het
Birc6 A G 17: 74,580,349 N891D probably benign Het
Car3 G T 3: 14,866,804 M78I probably benign Het
Cc2d2a A T 5: 43,730,029 H1267L probably benign Het
Cdk18 A G 1: 132,118,872 L192P probably damaging Het
Cdk9 A T 2: 32,709,824 Y134N probably damaging Het
Ceacam5 A T 7: 17,714,963 T85S probably benign Het
Cenpe A G 3: 135,246,586 T1403A probably benign Het
Chd8 C T 14: 52,219,757 G918D possibly damaging Het
Csnk1e T A 15: 79,419,898 probably benign Het
Dctpp1 A T 7: 127,257,193 I119N probably damaging Het
Defb34 T A 8: 19,123,768 F6Y unknown Het
Dvl1 C G 4: 155,854,775 N248K probably damaging Het
Dync1h1 T C 12: 110,651,747 probably benign Het
Eml5 T A 12: 98,865,479 R407W probably damaging Het
Epb41l5 T C 1: 119,623,958 D99G probably damaging Het
Fat1 A T 8: 45,051,168 N4566I possibly damaging Het
Gm21834 T C 17: 57,742,020 E67G possibly damaging Het
Gsap T A 5: 21,253,951 probably null Het
Guf1 T C 5: 69,558,580 I108T probably damaging Het
Hsd3b5 T C 3: 98,619,404 D242G probably damaging Het
Kcna7 A G 7: 45,409,690 D467G probably null Het
Lars A G 18: 42,242,784 probably benign Het
Lrrc56 A T 7: 141,206,453 D248V probably damaging Het
Map3k14 T A 11: 103,242,291 E27V possibly damaging Het
Med12l G A 3: 59,037,702 W116* probably null Het
Mgll A G 6: 88,725,817 R33G probably damaging Het
Mmp13 A G 9: 7,280,221 S384G possibly damaging Het
Nalcn C T 14: 123,370,032 C675Y probably benign Het
Nrxn1 A G 17: 91,088,689 L13P unknown Het
Ocstamp A G 2: 165,397,852 V138A probably damaging Het
Olfr1120 T G 2: 87,357,682 Y79* probably null Het
Olfr1240 A G 2: 89,440,138 V47A possibly damaging Het
Olfr1303 T C 2: 111,814,711 N5S probably damaging Het
Olfr1505 T G 19: 13,919,444 C141W probably damaging Het
Olfr372 T A 8: 72,058,162 S161T possibly damaging Het
Olfr470 A G 7: 107,845,116 S206P possibly damaging Het
Patj T C 4: 98,681,235 probably benign Het
Pcdhb22 A G 18: 37,518,727 I83V probably benign Het
Pclo A G 5: 14,669,656 E1269G unknown Het
Plagl2 T C 2: 153,236,053 T3A probably benign Het
Plcb1 C T 2: 135,294,911 P309S possibly damaging Het
Pld3 A T 7: 27,539,575 L175Q possibly damaging Het
Prrx1 A G 1: 163,248,405 probably benign Het
Psap T G 10: 60,299,566 probably benign Het
Ptgfr G A 3: 151,835,202 T223M probably damaging Het
Reep2 A T 18: 34,840,771 I6F probably benign Het
Rraga A G 4: 86,576,217 E100G probably benign Het
Rrm2b T C 15: 37,931,645 D37G probably benign Het
Rtl1 T C 12: 109,592,719 I895M probably damaging Het
Ryr1 G A 7: 29,074,609 A2445V probably damaging Het
Sbf1 C T 15: 89,302,329 D898N possibly damaging Het
Sh3d19 G A 3: 86,114,906 V548I possibly damaging Het
Shf C A 2: 122,368,635 probably benign Het
Sipa1l3 T C 7: 29,387,251 E638G probably damaging Het
Slc13a3 G T 2: 165,411,887 P449T probably damaging Het
Slc2a13 C T 15: 91,350,012 V374I possibly damaging Het
Slc4a7 T C 14: 14,794,059 probably null Het
Slc7a2 T A 8: 40,908,531 S414T probably benign Het
Slc9c1 A G 16: 45,573,356 E554G probably benign Het
Smad2 T C 18: 76,299,993 I332T probably damaging Het
Snrnp40 C T 4: 130,362,658 P59S probably damaging Het
Sorcs2 A T 5: 36,065,433 I154N probably damaging Het
Sort1 G A 3: 108,348,630 G631S probably damaging Het
Sox10 T C 15: 79,159,386 D149G possibly damaging Het
Spn C T 7: 127,136,208 V376M possibly damaging Het
Tacc2 A G 7: 130,577,509 D9G probably damaging Het
Tapt1 T G 5: 44,177,106 L514F possibly damaging Het
Tcf3 A G 10: 80,413,334 L480P probably damaging Het
Tenm4 G C 7: 96,774,020 G637A probably damaging Het
Tex14 T A 11: 87,520,699 N950K probably benign Het
Tgfbrap1 T G 1: 43,059,129 H497P probably benign Het
Tnfrsf18 A T 4: 156,026,529 Y48F possibly damaging Het
Tnxb A C 17: 34,683,548 H1002P probably damaging Het
Ttn A G 2: 76,763,227 probably benign Het
Ugt2b34 C G 5: 86,893,732 probably null Het
Vldlr A G 19: 27,238,263 D220G possibly damaging Het
Vmn1r33 A T 6: 66,612,137 Y144* probably null Het
Wdr60 T C 12: 116,248,290 D199G probably damaging Het
Wdr78 T C 4: 103,072,857 probably benign Het
Xrcc4 T C 13: 89,992,475 E205G possibly damaging Het
Other mutations in Atp4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:Atp4a APN 7 30713204 missense possibly damaging 0.95
IGL01327:Atp4a APN 7 30713250 missense possibly damaging 0.96
IGL01510:Atp4a APN 7 30720791 missense probably benign 0.02
IGL01763:Atp4a APN 7 30715518 missense probably benign 0.20
IGL02061:Atp4a APN 7 30715029 missense probably damaging 1.00
IGL02435:Atp4a APN 7 30717057 missense probably benign
IGL02903:Atp4a APN 7 30715919 missense probably benign 0.00
IGL03181:Atp4a APN 7 30724704 missense probably benign 0.02
IGL03350:Atp4a APN 7 30720867 missense probably damaging 1.00
sublytic UTSW 7 30715800 missense probably benign 0.32
IGL03097:Atp4a UTSW 7 30723037 missense probably benign 0.14
R0095:Atp4a UTSW 7 30720735 missense probably damaging 0.99
R0121:Atp4a UTSW 7 30720101 missense probably benign 0.00
R0140:Atp4a UTSW 7 30720101 missense probably benign 0.00
R0241:Atp4a UTSW 7 30717135 missense probably benign 0.00
R0437:Atp4a UTSW 7 30720101 missense probably benign 0.00
R1164:Atp4a UTSW 7 30717692 missense probably benign 0.00
R2105:Atp4a UTSW 7 30720368 critical splice donor site probably null
R2272:Atp4a UTSW 7 30715500 nonsense probably null
R2327:Atp4a UTSW 7 30720241 missense probably benign 0.16
R2881:Atp4a UTSW 7 30720225 missense probably benign 0.16
R2990:Atp4a UTSW 7 30720225 missense probably benign 0.16
R2992:Atp4a UTSW 7 30720225 missense probably benign 0.16
R2993:Atp4a UTSW 7 30720225 missense probably benign 0.16
R3123:Atp4a UTSW 7 30720225 missense probably benign 0.16
R3125:Atp4a UTSW 7 30720225 missense probably benign 0.16
R3441:Atp4a UTSW 7 30720225 missense probably benign 0.16
R3442:Atp4a UTSW 7 30720225 missense probably benign 0.16
R3686:Atp4a UTSW 7 30720225 missense probably benign 0.16
R3687:Atp4a UTSW 7 30720225 missense probably benign 0.16
R3845:Atp4a UTSW 7 30717115 missense probably null 0.99
R4027:Atp4a UTSW 7 30724952 splice site probably null
R4072:Atp4a UTSW 7 30715332 missense probably benign 0.09
R4433:Atp4a UTSW 7 30720225 missense probably benign 0.16
R4454:Atp4a UTSW 7 30720225 missense probably benign 0.16
R4457:Atp4a UTSW 7 30720225 missense probably benign 0.16
R4458:Atp4a UTSW 7 30720225 missense probably benign 0.16
R4510:Atp4a UTSW 7 30724253 nonsense probably null
R4511:Atp4a UTSW 7 30724253 nonsense probably null
R4576:Atp4a UTSW 7 30717722 missense probably benign 0.25
R4656:Atp4a UTSW 7 30719948 intron probably benign
R4661:Atp4a UTSW 7 30720225 missense probably benign 0.16
R4662:Atp4a UTSW 7 30720225 missense probably benign 0.16
R4852:Atp4a UTSW 7 30724268 missense probably benign 0.10
R4892:Atp4a UTSW 7 30712474 missense probably benign 0.07
R4907:Atp4a UTSW 7 30719092 missense possibly damaging 0.66
R5024:Atp4a UTSW 7 30715864 missense possibly damaging 0.82
R5254:Atp4a UTSW 7 30715530 missense probably damaging 1.00
R5318:Atp4a UTSW 7 30715329 missense probably damaging 1.00
R5340:Atp4a UTSW 7 30720806 missense probably benign
R5484:Atp4a UTSW 7 30720672 unclassified probably benign
R5729:Atp4a UTSW 7 30712426 missense possibly damaging 0.48
R5762:Atp4a UTSW 7 30719096 missense probably damaging 0.99
R5797:Atp4a UTSW 7 30712649 missense probably damaging 1.00
R6030:Atp4a UTSW 7 30722516 missense probably damaging 0.99
R6030:Atp4a UTSW 7 30722516 missense probably damaging 0.99
R6077:Atp4a UTSW 7 30715919 missense probably benign 0.00
R6243:Atp4a UTSW 7 30715957 missense possibly damaging 0.68
R6346:Atp4a UTSW 7 30715356 missense possibly damaging 0.84
R6459:Atp4a UTSW 7 30712462 missense probably benign 0.00
R6515:Atp4a UTSW 7 30712478 missense possibly damaging 0.78
R6773:Atp4a UTSW 7 30715377 missense probably damaging 0.98
R6854:Atp4a UTSW 7 30715008 missense probably benign 0.29
R7215:Atp4a UTSW 7 30717360 missense possibly damaging 0.61
R7271:Atp4a UTSW 7 30722519 missense probably benign 0.16
R7340:Atp4a UTSW 7 30716730 missense possibly damaging 0.94
R7457:Atp4a UTSW 7 30720767 missense probably benign 0.08
R7593:Atp4a UTSW 7 30724680 missense probably benign 0.08
R7712:Atp4a UTSW 7 30715553 missense probably damaging 0.96
R7762:Atp4a UTSW 7 30720036 missense probably damaging 0.96
Z1177:Atp4a UTSW 7 30717840 missense possibly damaging 0.47
Predicted Primers PCR Primer
(F):5'- AGTCTCCTCATCTGCCCAGTGG -3'
(R):5'- AACAGCTTAGCCGGGAAGCATC -3'

Sequencing Primer
(F):5'- tctgcccagtggggatg -3'
(R):5'- CAATTCGTGACAGTTACAGGTG -3'
Posted On2013-07-11