Incidental Mutation 'R7602:Ap3m2'
ID588066
Institutional Source Beutler Lab
Gene Symbol Ap3m2
Ensembl Gene ENSMUSG00000031539
Gene Nameadaptor-related protein complex 3, mu 2 subunit
SynonymsAP-3B, 5830445E16Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7602 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location22787354-22805622 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 22792754 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 256 (N256S)
Ref Sequence ENSEMBL: ENSMUSP00000128446 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000163739] [ENSMUST00000210656]
Predicted Effect probably benign
Transcript: ENSMUST00000163739
AA Change: N256S

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000128446
Gene: ENSMUSG00000031539
AA Change: N256S

DomainStartEndE-ValueType
Pfam:Clat_adaptor_s 1 137 2.7e-8 PFAM
Pfam:Adap_comp_sub 165 418 1.3e-76 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000210656
AA Change: N256S

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the heterotetrameric adaptor-related protein comlex 3 (AP-3), which belongs to the adaptor complexes medium subunits family. The AP-3 complex plays a role in protein trafficking to lysosomes and specialized organelles. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Aug 2008]
PHENOTYPE: Homozygous null mice suffer from spontaneous recurrent epileptic seizures, are more susceptible to drug-induced seizures and show impaired GABA release, fewer synaptic vesicles, enhanced long-term potentiation, and abnormal propagation of neuronal excitability via the temporoammonic pathway. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700023F06Rik T C 11: 103,200,178 M114V probably benign Het
1700025G04Rik A T 1: 151,980,515 Y34N probably damaging Het
5730559C18Rik G T 1: 136,225,397 C252* probably null Het
A2m T C 6: 121,642,007 V237A probably damaging Het
A2m A T 6: 121,670,936 D1129V possibly damaging Het
Abca7 A G 10: 79,998,012 probably null Het
Atr C T 9: 95,907,383 H1531Y possibly damaging Het
Carmil3 C T 14: 55,501,508 A873V probably null Het
Casp8 A C 1: 58,833,739 K258T probably benign Het
Cast A G 13: 74,736,965 S222P probably benign Het
Cpsf7 C T 19: 10,535,373 P274S probably damaging Het
Ddx24 A T 12: 103,416,260 L688* probably null Het
Ddx59 A G 1: 136,433,821 I475V probably benign Het
Dhx29 T A 13: 112,944,559 S376T possibly damaging Het
Dhx57 G T 17: 80,274,861 N438K probably benign Het
Dlk1 T A 12: 109,455,625 probably null Het
Epha6 T C 16: 59,775,568 D920G probably damaging Het
Exo5 A T 4: 120,921,621 V349E probably benign Het
Fam234b T C 6: 135,225,243 V321A possibly damaging Het
Gbp3 A G 3: 142,569,061 E383G probably benign Het
Gga2 T C 7: 121,997,330 N408S probably benign Het
Gm5346 C T 8: 43,626,666 G174R probably damaging Het
Gm8298 T C 3: 59,877,276 I390T probably benign Het
Gse1 T C 8: 120,569,304 V532A unknown Het
Hnrnpul2 T C 19: 8,831,309 Y712H probably damaging Het
Hpca T C 4: 129,120,226 probably benign Het
Ifitm3 A G 7: 141,010,459 F63L probably damaging Het
Kank1 A T 19: 25,422,161 T940S probably benign Het
Klhl9 C A 4: 88,722,409 probably benign Het
Krt36 T C 11: 100,102,960 M351V probably benign Het
Mthfd2 T C 6: 83,311,848 N125D probably benign Het
Muc4 C G 16: 32,753,930 Q1269E probably benign Het
Ncoa2 A G 1: 13,177,126 S358P possibly damaging Het
Nmnat1 T C 4: 149,473,351 H78R probably benign Het
Olfr1026 A T 2: 85,923,802 Y178F probably damaging Het
Olfr173 T C 16: 58,796,980 I289V possibly damaging Het
Olfr823 A G 10: 130,112,310 M160T probably benign Het
Olfr982 T G 9: 40,075,159 L288R probably damaging Het
Pabpc4 A T 4: 123,292,892 D302V possibly damaging Het
Pgap1 A T 1: 54,543,186 S167R probably damaging Het
Phf12 T C 11: 78,023,283 L517P probably benign Het
Rcan2 A G 17: 44,017,798 D86G probably benign Het
Ryk T C 9: 102,898,516 Y442H probably damaging Het
Scfd2 G T 5: 74,462,610 Q421K probably benign Het
Sirpa G T 2: 129,609,152 V111F probably damaging Het
Skint4 A T 4: 112,118,271 T143S possibly damaging Het
Slc12a8 C A 16: 33,625,124 H463N probably benign Het
Sp110 G A 1: 85,579,092 R417C Het
Sptlc2 A G 12: 87,341,689 Y340H probably damaging Het
Ssc5d T A 7: 4,942,746 W926R possibly damaging Het
Tgfa A G 6: 86,269,962 E82G probably damaging Het
Thrsp A G 7: 97,417,307 I66T probably damaging Het
Ttn T C 2: 76,851,644 E1003G unknown Het
Tube1 A T 10: 39,142,266 H113L probably benign Het
Uri1 A G 7: 37,981,628 V117A probably benign Het
Ush2a G A 1: 188,648,409 C2305Y probably damaging Het
Zbtb7a T G 10: 81,144,176 V68G probably damaging Het
Zfr T A 15: 12,159,677 D686E possibly damaging Het
Zscan4f G A 7: 11,401,381 S238N possibly damaging Het
Other mutations in Ap3m2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00510:Ap3m2 APN 8 22797227 splice site probably null
IGL01288:Ap3m2 APN 8 22803915 missense probably benign
IGL01391:Ap3m2 APN 8 22799647 missense probably benign 0.00
R0599:Ap3m2 UTSW 8 22793112 missense possibly damaging 0.88
R1566:Ap3m2 UTSW 8 22803951 missense probably damaging 1.00
R1576:Ap3m2 UTSW 8 22808467 unclassified probably benign
R2917:Ap3m2 UTSW 8 22799799 missense probably benign 0.00
R4884:Ap3m2 UTSW 8 22803981 missense probably damaging 1.00
R4995:Ap3m2 UTSW 8 22803776 missense probably benign 0.19
R5100:Ap3m2 UTSW 8 22789388 missense probably benign
R5738:Ap3m2 UTSW 8 22803861 missense possibly damaging 0.52
R7030:Ap3m2 UTSW 8 22799791 missense probably damaging 0.99
R7378:Ap3m2 UTSW 8 22804010 missense probably benign 0.31
R7732:Ap3m2 UTSW 8 22797089 missense probably benign 0.00
R7866:Ap3m2 UTSW 8 22799658 missense probably benign 0.02
R7949:Ap3m2 UTSW 8 22799658 missense probably benign 0.02
Z1177:Ap3m2 UTSW 8 22791321 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- AAGCAAGGTCCACTCAGTCC -3'
(R):5'- CACCTGCGTTGCTTCTCAAAG -3'

Sequencing Primer
(F):5'- GGTCCACTCAGTCCTCACAG -3'
(R):5'- CTGCGTTGCTTCTCAAAGGAAAC -3'
Posted On2019-10-24