Incidental Mutation 'R7602:Gse1'
ID588068
Institutional Source Beutler Lab
Gene Symbol Gse1
Ensembl Gene ENSMUSG00000031822
Gene Namegenetic suppressor element 1, coiled-coil protein
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.166) question?
Stock #R7602 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location120228456-120581390 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 120569304 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 532 (V532A)
Ref Sequence ENSEMBL: ENSMUSP00000034279 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034279] [ENSMUST00000118136] [ENSMUST00000120493] [ENSMUST00000127664]
Predicted Effect unknown
Transcript: ENSMUST00000034279
AA Change: V532A
SMART Domains Protein: ENSMUSP00000034279
Gene: ENSMUSG00000031822
AA Change: V532A

DomainStartEndE-ValueType
low complexity region 61 73 N/A INTRINSIC
Pfam:DUF3736 81 216 2.9e-21 PFAM
coiled coil region 329 414 N/A INTRINSIC
Pfam:DUF3736 742 883 9.7e-46 PFAM
low complexity region 959 973 N/A INTRINSIC
low complexity region 1103 1124 N/A INTRINSIC
coiled coil region 1133 1207 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000118136
AA Change: V522A
SMART Domains Protein: ENSMUSP00000112981
Gene: ENSMUSG00000031822
AA Change: V522A

DomainStartEndE-ValueType
low complexity region 51 63 N/A INTRINSIC
Pfam:DUF3736 70 203 2.2e-39 PFAM
low complexity region 204 211 N/A INTRINSIC
coiled coil region 319 404 N/A INTRINSIC
Pfam:DUF3736 731 874 7.5e-48 PFAM
low complexity region 949 963 N/A INTRINSIC
low complexity region 1093 1114 N/A INTRINSIC
coiled coil region 1123 1197 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000120493
AA Change: V519A
SMART Domains Protein: ENSMUSP00000113577
Gene: ENSMUSG00000031822
AA Change: V519A

DomainStartEndE-ValueType
low complexity region 48 60 N/A INTRINSIC
Pfam:DUF3736 67 200 2.2e-39 PFAM
low complexity region 201 208 N/A INTRINSIC
coiled coil region 316 401 N/A INTRINSIC
Pfam:DUF3736 728 871 7.5e-48 PFAM
low complexity region 946 960 N/A INTRINSIC
low complexity region 1090 1111 N/A INTRINSIC
coiled coil region 1120 1194 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (58/58)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700023F06Rik T C 11: 103,200,178 M114V probably benign Het
1700025G04Rik A T 1: 151,980,515 Y34N probably damaging Het
5730559C18Rik G T 1: 136,225,397 C252* probably null Het
A2m T C 6: 121,642,007 V237A probably damaging Het
A2m A T 6: 121,670,936 D1129V possibly damaging Het
Abca7 A G 10: 79,998,012 probably null Het
Ap3m2 T C 8: 22,792,754 N256S probably benign Het
Atr C T 9: 95,907,383 H1531Y possibly damaging Het
Carmil3 C T 14: 55,501,508 A873V probably null Het
Casp8 A C 1: 58,833,739 K258T probably benign Het
Cast A G 13: 74,736,965 S222P probably benign Het
Cpsf7 C T 19: 10,535,373 P274S probably damaging Het
Ddx24 A T 12: 103,416,260 L688* probably null Het
Ddx59 A G 1: 136,433,821 I475V probably benign Het
Dhx29 T A 13: 112,944,559 S376T possibly damaging Het
Dhx57 G T 17: 80,274,861 N438K probably benign Het
Dlk1 T A 12: 109,455,625 probably null Het
Epha6 T C 16: 59,775,568 D920G probably damaging Het
Exo5 A T 4: 120,921,621 V349E probably benign Het
Fam234b T C 6: 135,225,243 V321A possibly damaging Het
Gbp3 A G 3: 142,569,061 E383G probably benign Het
Gga2 T C 7: 121,997,330 N408S probably benign Het
Gm5346 C T 8: 43,626,666 G174R probably damaging Het
Gm8298 T C 3: 59,877,276 I390T probably benign Het
Hnrnpul2 T C 19: 8,831,309 Y712H probably damaging Het
Hpca T C 4: 129,120,226 probably benign Het
Ifitm3 A G 7: 141,010,459 F63L probably damaging Het
Kank1 A T 19: 25,422,161 T940S probably benign Het
Klhl9 C A 4: 88,722,409 probably benign Het
Krt36 T C 11: 100,102,960 M351V probably benign Het
Mthfd2 T C 6: 83,311,848 N125D probably benign Het
Muc4 C G 16: 32,753,930 Q1269E probably benign Het
Ncoa2 A G 1: 13,177,126 S358P possibly damaging Het
Nmnat1 T C 4: 149,473,351 H78R probably benign Het
Olfr1026 A T 2: 85,923,802 Y178F probably damaging Het
Olfr173 T C 16: 58,796,980 I289V possibly damaging Het
Olfr823 A G 10: 130,112,310 M160T probably benign Het
Olfr982 T G 9: 40,075,159 L288R probably damaging Het
Pabpc4 A T 4: 123,292,892 D302V possibly damaging Het
Pgap1 A T 1: 54,543,186 S167R probably damaging Het
Phf12 T C 11: 78,023,283 L517P probably benign Het
Rcan2 A G 17: 44,017,798 D86G probably benign Het
Ryk T C 9: 102,898,516 Y442H probably damaging Het
Scfd2 G T 5: 74,462,610 Q421K probably benign Het
Sirpa G T 2: 129,609,152 V111F probably damaging Het
Skint4 A T 4: 112,118,271 T143S possibly damaging Het
Slc12a8 C A 16: 33,625,124 H463N probably benign Het
Sp110 G A 1: 85,579,092 R417C Het
Sptlc2 A G 12: 87,341,689 Y340H probably damaging Het
Ssc5d T A 7: 4,942,746 W926R possibly damaging Het
Tgfa A G 6: 86,269,962 E82G probably damaging Het
Thrsp A G 7: 97,417,307 I66T probably damaging Het
Ttn T C 2: 76,851,644 E1003G unknown Het
Tube1 A T 10: 39,142,266 H113L probably benign Het
Uri1 A G 7: 37,981,628 V117A probably benign Het
Ush2a G A 1: 188,648,409 C2305Y probably damaging Het
Zbtb7a T G 10: 81,144,176 V68G probably damaging Het
Zfr T A 15: 12,159,677 D686E possibly damaging Het
Zscan4f G A 7: 11,401,381 S238N possibly damaging Het
Other mutations in Gse1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01407:Gse1 APN 8 120553587 start codon destroyed probably null 0.79
IGL02484:Gse1 APN 8 120575262 intron probably benign
IGL02931:Gse1 APN 8 120578069 intron probably benign
IGL03193:Gse1 APN 8 120571340 critical splice donor site probably null
R0027:Gse1 UTSW 8 120566546 intron probably benign
R0109:Gse1 UTSW 8 120567785 missense probably damaging 1.00
R0257:Gse1 UTSW 8 120572334 intron probably benign
R0967:Gse1 UTSW 8 120570855 intron probably benign
R1395:Gse1 UTSW 8 120574999 intron probably benign
R1480:Gse1 UTSW 8 120572394 intron probably benign
R1532:Gse1 UTSW 8 120568210 intron probably benign
R1649:Gse1 UTSW 8 120578515 intron probably benign
R1728:Gse1 UTSW 8 120568253 intron probably benign
R1742:Gse1 UTSW 8 120566950 missense probably damaging 1.00
R1784:Gse1 UTSW 8 120568253 intron probably benign
R2081:Gse1 UTSW 8 120566480 missense probably damaging 1.00
R2110:Gse1 UTSW 8 120566980 missense probably damaging 1.00
R2974:Gse1 UTSW 8 120570897 intron probably benign
R3615:Gse1 UTSW 8 120572742 intron probably benign
R3616:Gse1 UTSW 8 120572742 intron probably benign
R3857:Gse1 UTSW 8 120571133 intron probably benign
R4201:Gse1 UTSW 8 120567764 missense probably benign 0.39
R4494:Gse1 UTSW 8 120570814 intron probably benign
R4857:Gse1 UTSW 8 120572757 intron probably benign
R4911:Gse1 UTSW 8 120568466 intron probably benign
R5640:Gse1 UTSW 8 120562677 missense possibly damaging 0.65
R5782:Gse1 UTSW 8 120566521 missense probably damaging 1.00
R5980:Gse1 UTSW 8 120229637 intron probably benign
R6090:Gse1 UTSW 8 120571169 intron probably benign
R6156:Gse1 UTSW 8 120489127 missense possibly damaging 0.95
R6191:Gse1 UTSW 8 120553803 critical splice donor site probably null
R6270:Gse1 UTSW 8 120569163 intron probably benign
R6502:Gse1 UTSW 8 120553689 unclassified probably null
R6573:Gse1 UTSW 8 120567797 missense probably damaging 1.00
R6885:Gse1 UTSW 8 120229482 intron probably benign
R6901:Gse1 UTSW 8 120229822 intron probably benign
R6959:Gse1 UTSW 8 120570971 intron probably benign
R7023:Gse1 UTSW 8 120230648 intron probably benign
R7210:Gse1 UTSW 8 120230702 missense unknown
R7263:Gse1 UTSW 8 120574171 missense unknown
R7449:Gse1 UTSW 8 120229711 missense unknown
R7627:Gse1 UTSW 8 120572777 missense unknown
R7635:Gse1 UTSW 8 120572895 missense unknown
R7689:Gse1 UTSW 8 120568478 missense unknown
X0026:Gse1 UTSW 8 120568163 nonsense probably null
Z1177:Gse1 UTSW 8 120229852 missense unknown
Predicted Primers PCR Primer
(F):5'- TTCCTCCCACAGAGAAGCTG -3'
(R):5'- AACACAGATGCTGAGGGCTG -3'

Sequencing Primer
(F):5'- CTGAAGGACGTGGGCTTGC -3'
(R):5'- CTGAGGGCTGGAGTGGTACAG -3'
Posted On2019-10-24