Incidental Mutation 'R7602:Ryk'
ID588071
Institutional Source Beutler Lab
Gene Symbol Ryk
Ensembl Gene ENSMUSG00000032547
Gene Namereceptor-like tyrosine kinase
SynonymsVik, ERK-3
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7602 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location102834917-102908305 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 102898516 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 442 (Y442H)
Ref Sequence ENSEMBL: ENSMUSP00000135858 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035142] [ENSMUST00000175883] [ENSMUST00000176198]
Predicted Effect probably damaging
Transcript: ENSMUST00000035142
AA Change: Y439H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000035142
Gene: ENSMUSG00000032547
AA Change: Y439H

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
WIF 47 180 9.24e-82 SMART
transmembrane domain 212 234 N/A INTRINSIC
low complexity region 247 266 N/A INTRINSIC
TyrKc 314 580 1.76e-115 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000175883
AA Change: Y442H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135858
Gene: ENSMUSG00000032547
AA Change: Y442H

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
WIF 47 180 9.24e-82 SMART
transmembrane domain 212 234 N/A INTRINSIC
low complexity region 247 266 N/A INTRINSIC
TyrKc 317 583 1.76e-115 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176198
SMART Domains Protein: ENSMUSP00000135396
Gene: ENSMUSG00000032547

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an atypical member of the family of growth factor receptor protein tyrosine kinases, differing from other members at a number of conserved residues in the activation and nucleotide binding domains. This gene product belongs to a subfamily whose members do not appear to be regulated by phosphorylation in the activation segment. It has been suggested that mediation of biological activity by recruitment of a signaling-competent auxiliary protein may occur through an as yet uncharacterized mechanism. The encoded protein has a leucine-rich extracellular domain with a WIF-type Wnt binding region, a single transmembrane domain, and an intracellular tyrosine kinase domain. This protein is involved in stimulating Wnt signaling pathways such as the regulation of axon pathfinding. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Feb 2012]
PHENOTYPE: Homozygous null mice have a distinctive craniofacial appearance, shortened limbs and postnatal mortality due to feeding and respiratory complications associated with a complete cleft of the secondary palate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700023F06Rik T C 11: 103,200,178 M114V probably benign Het
1700025G04Rik A T 1: 151,980,515 Y34N probably damaging Het
5730559C18Rik G T 1: 136,225,397 C252* probably null Het
A2m T C 6: 121,642,007 V237A probably damaging Het
A2m A T 6: 121,670,936 D1129V possibly damaging Het
Abca7 A G 10: 79,998,012 probably null Het
Ap3m2 T C 8: 22,792,754 N256S probably benign Het
Atr C T 9: 95,907,383 H1531Y possibly damaging Het
Carmil3 C T 14: 55,501,508 A873V probably null Het
Casp8 A C 1: 58,833,739 K258T probably benign Het
Cast A G 13: 74,736,965 S222P probably benign Het
Cpsf7 C T 19: 10,535,373 P274S probably damaging Het
Ddx24 A T 12: 103,416,260 L688* probably null Het
Ddx59 A G 1: 136,433,821 I475V probably benign Het
Dhx29 T A 13: 112,944,559 S376T possibly damaging Het
Dhx57 G T 17: 80,274,861 N438K probably benign Het
Dlk1 T A 12: 109,455,625 probably null Het
Epha6 T C 16: 59,775,568 D920G probably damaging Het
Exo5 A T 4: 120,921,621 V349E probably benign Het
Fam234b T C 6: 135,225,243 V321A possibly damaging Het
Gbp3 A G 3: 142,569,061 E383G probably benign Het
Gga2 T C 7: 121,997,330 N408S probably benign Het
Gm5346 C T 8: 43,626,666 G174R probably damaging Het
Gm8298 T C 3: 59,877,276 I390T probably benign Het
Gse1 T C 8: 120,569,304 V532A unknown Het
Hnrnpul2 T C 19: 8,831,309 Y712H probably damaging Het
Hpca T C 4: 129,120,226 probably benign Het
Ifitm3 A G 7: 141,010,459 F63L probably damaging Het
Kank1 A T 19: 25,422,161 T940S probably benign Het
Klhl9 C A 4: 88,722,409 probably benign Het
Krt36 T C 11: 100,102,960 M351V probably benign Het
Mthfd2 T C 6: 83,311,848 N125D probably benign Het
Muc4 C G 16: 32,753,930 Q1269E probably benign Het
Ncoa2 A G 1: 13,177,126 S358P possibly damaging Het
Nmnat1 T C 4: 149,473,351 H78R probably benign Het
Olfr1026 A T 2: 85,923,802 Y178F probably damaging Het
Olfr173 T C 16: 58,796,980 I289V possibly damaging Het
Olfr823 A G 10: 130,112,310 M160T probably benign Het
Olfr982 T G 9: 40,075,159 L288R probably damaging Het
Pabpc4 A T 4: 123,292,892 D302V possibly damaging Het
Pgap1 A T 1: 54,543,186 S167R probably damaging Het
Phf12 T C 11: 78,023,283 L517P probably benign Het
Rcan2 A G 17: 44,017,798 D86G probably benign Het
Scfd2 G T 5: 74,462,610 Q421K probably benign Het
Sirpa G T 2: 129,609,152 V111F probably damaging Het
Skint4 A T 4: 112,118,271 T143S possibly damaging Het
Slc12a8 C A 16: 33,625,124 H463N probably benign Het
Sp110 G A 1: 85,579,092 R417C Het
Sptlc2 A G 12: 87,341,689 Y340H probably damaging Het
Ssc5d T A 7: 4,942,746 W926R possibly damaging Het
Tgfa A G 6: 86,269,962 E82G probably damaging Het
Thrsp A G 7: 97,417,307 I66T probably damaging Het
Ttn T C 2: 76,851,644 E1003G unknown Het
Tube1 A T 10: 39,142,266 H113L probably benign Het
Uri1 A G 7: 37,981,628 V117A probably benign Het
Ush2a G A 1: 188,648,409 C2305Y probably damaging Het
Zbtb7a T G 10: 81,144,176 V68G probably damaging Het
Zfr T A 15: 12,159,677 D686E possibly damaging Het
Zscan4f G A 7: 11,401,381 S238N possibly damaging Het
Other mutations in Ryk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01532:Ryk APN 9 102897266 missense probably benign 0.38
R1168:Ryk UTSW 9 102898475 missense probably damaging 1.00
R1827:Ryk UTSW 9 102888507 missense probably benign 0.03
R2030:Ryk UTSW 9 102881656 missense possibly damaging 0.90
R2084:Ryk UTSW 9 102875772 missense probably damaging 1.00
R3870:Ryk UTSW 9 102891228 missense probably damaging 0.96
R4675:Ryk UTSW 9 102891216 missense possibly damaging 0.94
R5195:Ryk UTSW 9 102867613 missense probably benign 0.00
R5338:Ryk UTSW 9 102897317 nonsense probably null
R5469:Ryk UTSW 9 102906954 missense possibly damaging 0.76
R6668:Ryk UTSW 9 102869276 missense possibly damaging 0.75
R7340:Ryk UTSW 9 102898538 missense probably damaging 0.99
R7545:Ryk UTSW 9 102888473 missense probably damaging 1.00
R7694:Ryk UTSW 9 102898780 missense probably damaging 1.00
R7817:Ryk UTSW 9 102891233 nonsense probably null
X0020:Ryk UTSW 9 102881743 missense probably damaging 0.96
X0066:Ryk UTSW 9 102869410 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GCCAGAGCACATCTTGGTTG -3'
(R):5'- TGTCGTCGATGCTGAAGAGAG -3'

Sequencing Primer
(F):5'- CAAAATCTCAGTAAGTAGGTCCAAG -3'
(R):5'- TCGATGCTGAAGAGAGAGACATGAAC -3'
Posted On2019-10-24